Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29561
Trapped Gene
Rbmx (ENSMUSG00000031134)
Vector Insertion
Chr X: 54644743 - 54646140
Public Clones E326H11 (ggtc) IST14442G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700391 (ChrX:54646029..54646139 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGTTCTGAAAATCGGTAGC ChrX:54646105..54646124 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700391 (ChrX:54646029..54646139 -)
Downstram Exon
ENSMUSE00000700384 (ChrX:54644744..54644878 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGTTCTGAAAATCGGTAGC ChrX:54646105..54646124 59.71 50 CTCTTAACCGATGGGGGTCT ChrX:54644836..54644855 60.32 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000206702 ChrX:54646029..54646158 CCGTTCTGAAAATCGGTAGC ChrX:54646105..54646124 59.71 50
upstream ENSMUSE00000700386 ChrX:54646029..54646213 CCGTTCTGAAAATCGGTAGC ChrX:54646105..54646124 59.71 50
upstream ENSMUSE00000700391 ChrX:54646029..54646139 CCGTTCTGAAAATCGGTAGC ChrX:54646105..54646124 59.71 50
upstream ENSMUSE00000206699 ChrX:54644744..54644875 TGTTTGGCAAATATGGACGA ChrX:54644754..54644773 59.93 40
upstream ENSMUSE00000700384 ChrX:54644744..54644878 TGTTTGGCAAATATGGACGA ChrX:54644754..54644773 59.93 40
upstream ENSMUSE00000700390 ChrX:54644744..54644859 TGTTTGGCAAATATGGACGA ChrX:54644754..54644773 59.93 40

*** Putative Vector Insertion (Chr X: 54644743 - 54646140) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206698 ChrX:54644449..54644555 TCGTTTCTCGGTCCTTCATC ChrX:54644507..54644526 60.19 50
downstream ENSMUSE00000206701 ChrX:54643241..54643412 GTGGGGGTAGTCCACGTCTA ChrX:54643312..54643331 59.84 60
downstream ENSMUSE00000206704 ChrX:54642596..54642748 ACGAACTGGTCCAGAAGGTG ChrX:54642599..54642618 60.15 55
downstream ENSMUSE00000206706 ChrX:54641922..54642036 GGCCTCCGTAACCATCTCTT ChrX:54641979..54641998 60.46 55
downstream ENSMUSE00000206695 ChrX:54641699..54641824 TGGTGGTGCATAATCTCGTG ChrX:54641748..54641767 60.54 50
downstream ENSMUSE00000206696 ChrX:54641238..54641320 GATCCCGACCATAGCCATCT ChrX:54641273..54641292 61.22 55
downstream ENSMUSE00000700382 ChrX:54639539..54640570 ATCACTTCGGCTGCTTGAGT ChrX:54640415..54640434 60.02 50
downstream ENSMUSE00000359850 ChrX:54639535..54640570 ATCACTTCGGCTGCTTGAGT ChrX:54640415..54640434 60.02 50
downstream ENSMUSE00000700392 ChrX:54639523..54640570 ATCACTTCGGCTGCTTGAGT ChrX:54640415..54640434 60.02 50
downstream ENSMUSE00000634881 ChrX:54639207..54641320 GAGGTACGGAAACGGATTGA ChrX:54640711..54640730 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGTTCTGAAAATCGGTAGC ChrX:54646103..54646123 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTTCTGAAAATCGGTAGC ChrX:54646103..54646123 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031134