Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29572
Trapped Gene
Ldlrad3 (ENSMUSG00000048058)
Vector Insertion
Chr 2: 101954317 - 102026516
Public Clones (sanger) (sanger) (sanger) E325E05 (ggtc) D118F10 (ggtc) 5SE285B07 (ggtc)
E077E03 (ggtc) (ggtc) D172E05 (ggtc) E324E12 (ggtc) E038E11 (ggtc)
D118F10 (ggtc) E112E08 (ggtc) (ggtc) D172E05 (ggtc) CMHD-GT_536A3-5S (cmhd)
IST10735B2 (tigm) IST10735B2 (tigm) IST10817H1 (tigm) IST14939F12 (tigm)
IST10332H5 (tigm) IST10817H1 (tigm) IST14356H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000378318 (Chr2:102026437..102026515 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000378318 (Chr2:102026437..102026515 -)
Downstram Exon
ENSMUSE00000687104 (Chr2:101954318..101954341 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AATTGGTGCAAAATCCCAAA Chr2:101954299..101954318 60.17 35

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000378318 Chr2:102026437..102026515 No primer for this exon
upstream ENSMUSE00000687112 Chr2:102026437..102026534 No primer for this exon
upstream ENSMUSE00000687104 Chr2:101954318..101954341 TTGGGATTTTGCACCAATTT Chr2:101954320..101954339 60.17 35

*** Putative Vector Insertion (Chr 2: 101954317 - 102026516) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687105 Chr2:101953786..101953836 ATGTTGCACTCGTTGGTGAA Chr2:101953769..101953788 60.16 45
downstream ENSMUSE00000564528 Chr2:101953690..101953861 ATGTTGCACTCGTTGGTGAA Chr2:101953769..101953788 60.16 45
downstream ENSMUSE00000564530 Chr2:101953690..101953836 ATGTTGCACTCGTTGGTGAA Chr2:101953769..101953788 60.16 45
downstream ENSMUSE00000643018 Chr2:101910090..101910215 GTCGGGACAGTCCTCAAATC Chr2:101910090..101910109 59.51 55
downstream ENSMUSE00000643016 Chr2:101898064..101898198 TGAAGCTCTTGTCGATGCAC Chr2:101898105..101898124 60.14 50
downstream ENSMUSE00000643015 Chr2:101794986..101795331 AGGGTCATGAGGTTGTTTCG Chr2:101795147..101795166 59.97 50
downstream ENSMUSE00000470570 Chr2:101793221..101793332 AGGAAGGTCGTACCATGCAG Chr2:101793289..101793308 60.13 55
downstream ENSMUSE00000687103 Chr2:101793138..101793218 CTGCTGGCTTCCACACTCAG Chr2:101793158..101793177 62.17 60
downstream ENSMUSE00000461346 Chr2:101790360..101793332 TTTTGACCGGCTTAATTTGG Chr2:101792180..101792199 59.94 40
downstream ENSMUSE00000469702 Chr2:101790358..101793332 TTTTGACCGGCTTAATTTGG Chr2:101792180..101792199 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATGGTGTCTGGGTTTTCTC Chr2:102005495..102005516 59.96 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATGGTGTCTGGGTTTTCTC Chr2:102005495..102005516 59.96 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048058