Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29579
Trapped Gene
Fat1 (ENSMUSG00000070047)
Vector Insertion
Chr 8: 46038836 - 46074284
Public Clones (sanger) (sanger) (sanger) E323A04 (ggtc) E324H07 (ggtc) E324E02 (ggtc)
E323A04 (ggtc) E324H07 (ggtc) E323H01 (ggtc) E325B04 (ggtc) E324E02 (ggtc)
IST11770B1 (tigm) IST13225H10 (tigm) IST12590A7 (tigm) IST11770B1 (tigm)
IST12590A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683900 (Chr8:46035568..46038835 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683900 (Chr8:46035568..46038835 +)
Downstram Exon
ENSMUSE00000637106 (Chr8:46074285..46074599 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55 TCTGTGGCATAGACCGTGAG Chr8:46074360..46074379 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683877 Chr8:46035568..46038835 GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55
upstream ENSMUSE00000683900 Chr8:46035568..46038835 GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55

*** Putative Vector Insertion (Chr 8: 46038836 - 46074284) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637106 Chr8:46074285..46074599 TCTGTGGCATAGACCGTGAG Chr8:46074360..46074379 59.85 55
downstream ENSMUSE00000608098 Chr8:46092596..46092657 CTCGACGTGGTTGTGATGAG Chr8:46092620..46092639 60.31 55
downstream ENSMUSE00000608097 Chr8:46095147..46095479 GTTTTGGGTTCGATGGAGAA Chr8:46095427..46095446 59.91 45
downstream ENSMUSE00000637101 Chr8:46095755..46095965 CACTCGATATGGAGCCTGGT Chr8:46095819..46095838 60.1 55
downstream ENSMUSE00000637100 Chr8:46098318..46098457 GTTCTGCATCAAGGGGCTTA Chr8:46098398..46098417 60.21 50
downstream ENSMUSE00000608094 Chr8:46102719..46102994 CATGGTCAAGCTTTTCAGCA Chr8:46102965..46102984 59.99 45
downstream ENSMUSE00000608093 Chr8:46103189..46103399 TTGACAACAATCCTGGCAAA Chr8:46103244..46103263 60.09 40
downstream ENSMUSE00000637097 Chr8:46108158..46112225 CCCGATGTTCACCTCGTACT Chr8:46111168..46111187 59.99 55
downstream ENSMUSE00000637096 Chr8:46112838..46113034 GTCGTTGGCATCGAGAACTT Chr8:46113016..46113035 60.26 50
downstream ENSMUSE00000683894 Chr8:46114810..46114963 AGACCTGCATGACCAGCTTC Chr8:46114873..46114892 60.42 55
downstream ENSMUSE00000637126 Chr8:46115466..46115699 GTCCGTGGCCTTGACTAGAA Chr8:46115542..46115561 60.26 55
downstream ENSMUSE00000637125 Chr8:46116619..46117008 ATTCGACCAGCGAGTAGGAA Chr8:46116657..46116676 59.84 50
downstream ENSMUSE00000637124 Chr8:46118693..46118907 GGGGCTGTTATCGTTGATGT Chr8:46118841..46118860 59.82 50
downstream ENSMUSE00000608088 Chr8:46118709..46118907 GGGGCTGTTATCGTTGATGT Chr8:46118841..46118860 59.82 50
downstream ENSMUSE00000608087 Chr8:46119186..46119323 GGGTCAATTGTGAACGGACT Chr8:46119280..46119299 59.83 50
downstream ENSMUSE00000637123 Chr8:46119186..46119323 GGGTCAATTGTGAACGGACT Chr8:46119280..46119299 59.83 50
downstream ENSMUSE00000608086 Chr8:46120819..46120962 CACCGTGGTTGTGTTGACTC Chr8:46120893..46120912 60.05 55
downstream ENSMUSE00000608085 Chr8:46121473..46121670 CACCTCAAAGGCGTTTTCAT Chr8:46121598..46121617 60.11 45
downstream ENSMUSE00000608084 Chr8:46122030..46122831 ATTTCCTCAACGTCCGTCAC Chr8:46122658..46122677 59.97 50
downstream ENSMUSE00000608083 Chr8:46123614..46123745 GGGCACACGCAGCTATACTT Chr8:46123722..46123741 60.3 55
downstream ENSMUSE00000608082 Chr8:46125154..46125311 GCGGTACTTCACGAAGCTGT Chr8:46125203..46125222 60.46 55
downstream ENSMUSE00000683886 Chr8:46125154..46125305 GCGGTACTTCACGAAGCTGT Chr8:46125203..46125222 60.46 55
downstream ENSMUSE00000608081 Chr8:46125888..46126350 TCGTTGACCTGAATGCTCTG Chr8:46125973..46125992 59.98 50
downstream ENSMUSE00000683884 Chr8:46125933..46126350 TCGTTGACCTGAATGCTCTG Chr8:46125973..46125992 59.98 50
downstream ENSMUSE00000608080 Chr8:46127234..46127387 GCGCTGCACTTGCAGTAATA Chr8:46127258..46127277 60.19 50
downstream ENSMUSE00000683876 Chr8:46127234..46127365 GCGCTGCACTTGCAGTAATA Chr8:46127258..46127277 60.19 50
downstream ENSMUSE00000683882 Chr8:46127234..46127380 GCGCTGCACTTGCAGTAATA Chr8:46127258..46127277 60.19 50
downstream ENSMUSE00000683875 Chr8:46127386..46127416 No primer for this exon
downstream ENSMUSE00000683880 Chr8:46127517..46127673 GCACCATCCAAACTGTCAAA Chr8:46127640..46127659 59.55 45
downstream ENSMUSE00000608079 Chr8:46127563..46127673 TCCCCTAAAGCCTGAGTCAC Chr8:46127671..46127690 59.28 55
downstream ENSMUSE00000608078 Chr8:46129277..46129908 GAATTGCGGTCAAGGTTGTT Chr8:46129726..46129745 59.98 45
downstream ENSMUSE00000608077 Chr8:46130385..46130522 AAGGAGCTAAGCGACTGCAC Chr8:46130499..46130518 59.79 55
downstream ENSMUSE00000637111 Chr8:46135196..46135231 GTCAGGAGCAGCCAAAGATT Chr8:46135218..46135237 59.43 50
downstream ENSMUSE00000683873 Chr8:46136135..46137590 ACCCGGTCGATTACAGTCAG Chr8:46136963..46136982 59.99 55
downstream ENSMUSE00000683879 Chr8:46136135..46137611 ACCCGGTCGATTACAGTCAG Chr8:46136963..46136982 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACTGGGTTAATCGCCTTG Chr8:46050878..46050898 59.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCCCTGATTCCCTGATAA Chr8:46050833..46050853 59.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070047