Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29594
Trapped Gene
Cnpy3 (ENSMUSG00000023973)
Vector Insertion
Chr 17: 46884369 - 46889136
Public Clones E323A12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000378046 (Chr17:46888922..46889135 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGCTGCCTCTTATTTCCTT Chr17:46889027..46889046 60.7 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000378046 (Chr17:46888922..46889135 -)
Downstram Exon
ENSMUSE00000136887 (Chr17:46884370..46884493 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGCTGCCTCTTATTTCCTT Chr17:46889027..46889046 60.7 50 TCTTTCCCGTTTCCTCAAAA Chr17:46884418..46884437 59.66 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000378046 Chr17:46888922..46889135 CCGCTGCCTCTTATTTCCTT Chr17:46889027..46889046 60.7 50
upstream ENSMUSE00000720874 Chr17:46888922..46889144 CCGCTGCCTCTTATTTCCTT Chr17:46889027..46889046 60.7 50
upstream ENSMUSE00000136887 Chr17:46884370..46884493 AGCTGAAGTCGGCTTTTGAG Chr17:46884453..46884472 59.76 50

*** Putative Vector Insertion (Chr 17: 46884369 - 46889136) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000719241 Chr17:46883936..46884149 CTTAACCCCTGAGGGTCTCC Chr17:46884015..46884034 59.93 60
downstream ENSMUSE00000386453 Chr17:46880135..46880231 CTTGTGCAGGCTGTAGTCCA Chr17:46880143..46880162 60.05 55
downstream ENSMUSE00000340567 Chr17:46874676..46874798 CTAGGTTGTGCAGCGTCTCA Chr17:46874740..46874759 60.2 55
downstream ENSMUSE00000136886 Chr17:46874124..46874241 AACTCTTCCACCAGCACGTC Chr17:46874197..46874216 60.31 55
downstream ENSMUSE00000380834 Chr17:46872707..46873857 ATCGATGAGGGGACACTCTG Chr17:46872918..46872937 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:46886066..46886086 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGCGTGACTGGGAAAACC Chr17:46889069..46889089 63.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023973