Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29595
Trapped Gene
Ighmbp2 (ENSMUSG00000024831)
Vector Insertion
Chr 19: 3281418 - 3282907
Public Clones (sanger) E140G12 (ggtc) E140H12 (ggtc) IST14556H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000375528 (Chr19:3282701..3282906 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCTGGTCCAGTGGGGAAC Chr19:3282868..3282887 61.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000375528 (Chr19:3282701..3282906 -)
Downstram Exon
ENSMUSE00000145354 (Chr19:3281419..3281588 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCTGGTCCAGTGGGGAAC Chr19:3282868..3282887 61.15 55 ACCACTGCAGGTCCAAACTT Chr19:3281423..3281442 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375528 Chr19:3282701..3282906 ATTCTGGTCCAGTGGGGAAC Chr19:3282868..3282887 61.15 55
upstream ENSMUSE00000718699 Chr19:3282701..3282979 ATTCTGGTCCAGTGGGGAAC Chr19:3282868..3282887 61.15 55
upstream ENSMUSE00000145354 Chr19:3281419..3281588 AAGTTTGGACCTGCAGTGGT Chr19:3281445..3281464 59.62 50

*** Putative Vector Insertion (Chr 19: 3281418 - 3282907) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145357 Chr19:3279807..3279996 TAGGTGACATCGTTGGCAAG Chr19:3279800..3279819 59.72 50
downstream ENSMUSE00000145379 Chr19:3279533..3279630 TGCCCAACAGGATGTCTATG Chr19:3279541..3279560 59.52 50
downstream ENSMUSE00000145369 Chr19:3276756..3276919 CTGGGAAAGGTCCAGAGTTG Chr19:3276857..3276876 59.69 55
downstream ENSMUSE00000357259 Chr19:3274356..3274556 ACAATCTGGGCGTTGTCACT Chr19:3274368..3274387 60.58 50
downstream ENSMUSE00000145376 Chr19:3272888..3273035 GGCTCTGAACTATGGCTGCT Chr19:3272902..3272921 59.6 55
downstream ENSMUSE00000145352 Chr19:3271526..3271700 CCCAGCTAGGATGCACTTTG Chr19:3271542..3271561 60.79 55
downstream ENSMUSE00000145372 Chr19:3268660..3268842 GTAAGCTGCCCGTGGTACAT Chr19:3268671..3268690 60.02 55
downstream ENSMUSE00000145393 Chr19:3268298..3268416 GACTGGCTGTCCTCCTCCTC Chr19:3268290..3268309 61.36 65
downstream ENSMUSE00000145388 Chr19:3267242..3267336 AGGTTGTAGGGTGCGATGAC Chr19:3267224..3267243 60 55
downstream ENSMUSE00000333699 Chr19:3266336..3266459 CTCTTTCTCTCGGCCTTGAA Chr19:3266351..3266370 59.69 50
downstream ENSMUSE00000145390 Chr19:3264811..3265665 GCCACAAACTCCTCAATCGT Chr19:3265190..3265209 60.12 50
downstream ENSMUSE00000236257 Chr19:3261975..3262144 CAGTAGCGGTGGCTACAGTG Chr19:3261975..3261994 59.53 60
downstream ENSMUSE00000713794 Chr19:3260924..3261635 GGCCAGGCCATTACAGACTA Chr19:3261091..3261110 60.1 55
downstream ENSMUSE00000384377 Chr19:3259364..3261635 ACCCAAAGGCACACTACAGG Chr19:3259958..3259977 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTAATCGCCTTGCAGCACA Chr19:3282838..3282858 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCTGGTCCAGTGGGGAAC Chr19:3282866..3282887 62.97 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024831