Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2960
Trapped Gene
Apool (ENSMUSG00000025525)
Vector Insertion
Chr X: 109467862 - 109477765
Public Clones AC0470 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151404 (ChrX:109467770..109467861 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCACATTAGGAGCGACTGT ChrX:109467808..109467827 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151404 (ChrX:109467770..109467861 +)
Downstram Exon
ENSMUSE00000151401 (ChrX:109477766..109477879 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCACATTAGGAGCGACTGT ChrX:109467808..109467827 60.28 55 GGTTCAGGGAGTGATTCGTT ChrX:109477866..109477885 58.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695473 ChrX:109424975..109425045 CATAGGTATGGCGGCCTTTA ChrX:109425024..109425043 59.94 50
upstream ENSMUSE00000386803 ChrX:109425017..109425045 CATAGGTATGGCGGCCTTTA ChrX:109425024..109425043 59.94 50
upstream ENSMUSE00000695470 ChrX:109447395..109447499 TAAATGTGCGTCTTGCCAAA ChrX:109447456..109447475 60.25 40
upstream ENSMUSE00000346346 ChrX:109447410..109447514 TAAATGTGCGTCTTGCCAAA ChrX:109447456..109447475 60.25 40
upstream ENSMUSE00000695469 ChrX:109451619..109451626 No primer for this exon
upstream ENSMUSE00000695468 ChrX:109452032..109452044 No primer for this exon
upstream ENSMUSE00000695467 ChrX:109459749..109459765 No primer for this exon
upstream ENSMUSE00000383852 ChrX:109459847..109459966 GCTTTGCATCCATCCGTACT ChrX:109459917..109459936 60.1 50
upstream ENSMUSE00000695466 ChrX:109459849..109459966 GCTTTGCATCCATCCGTACT ChrX:109459917..109459936 60.1 50
upstream ENSMUSE00000151403 ChrX:109463410..109463464 No primer for this exon
upstream ENSMUSE00000151399 ChrX:109464909..109465007 GATTACAGCTTCGGGACTGG ChrX:109464964..109464983 59.69 55
upstream ENSMUSE00000151404 ChrX:109467770..109467861 GCCACATTAGGAGCGACTGT ChrX:109467808..109467827 60.28 55

*** Putative Vector Insertion (Chr X: 109467862 - 109477765) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151401 ChrX:109477766..109477879 GGTTCAGGGAGTGATTCGTT ChrX:109477866..109477885 58.99 50
downstream ENSMUSE00000358778 ChrX:109478071..109478179 AAGCTGGCATGGATTTCATC ChrX:109478105..109478124 60.04 45
downstream ENSMUSE00000397805 ChrX:109485803..109486038 GATGAGACTGCCCATGATCC ChrX:109485859..109485878 60.45 55
downstream ENSMUSE00000695471 ChrX:109485803..109486039 GATGAGACTGCCCATGATCC ChrX:109485859..109485878 60.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGCTACCCAGCTCAGTCA ChrX:109467828..109467848 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACTTCGTGACTGGGAAAA ChrX:109473906..109473927 60.65 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025525