Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29611
Trapped Gene
Myo1c (ENSMUSG00000017774)
Vector Insertion
Chr 11: 75465168 - 75465651
Public Clones E139A07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661774 (Chr11:75465011..75465167 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661774 (Chr11:75465011..75465167 +)
Downstram Exon
ENSMUSE00000661770 (Chr11:75465652..75465845 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676714 Chr11:75464192..75464266 No primer for this exon
upstream ENSMUSE00000661774 Chr11:75465011..75465167 No primer for this exon

*** Putative Vector Insertion (Chr 11: 75465168 - 75465651) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661770 Chr11:75465652..75465845 No primer for this exon
downstream ENSMUSE00000710573 Chr11:75469517..75469703 No primer for this exon
downstream ENSMUSE00000711366 Chr11:75469517..75469703 No primer for this exon
downstream ENSMUSE00000676710 Chr11:75469810..75469893 No primer for this exon
downstream ENSMUSE00000502655 Chr11:75470994..75471149 No primer for this exon
downstream ENSMUSE00000710491 Chr11:75470994..75471149 No primer for this exon
downstream ENSMUSE00000721003 Chr11:75470994..75471149 No primer for this exon
downstream ENSMUSE00000676707 Chr11:75471255..75471370 No primer for this exon
downstream ENSMUSE00000676713 Chr11:75471255..75471370 No primer for this exon
downstream ENSMUSE00000297192 Chr11:75471854..75472052 No primer for this exon
downstream ENSMUSE00000650619 Chr11:75471854..75472052 No primer for this exon
downstream ENSMUSE00000676712 Chr11:75472141..75472221 No primer for this exon
downstream ENSMUSE00000110432 Chr11:75473673..75473852 No primer for this exon
downstream ENSMUSE00000110413 Chr11:75473935..75474033 No primer for this exon
downstream ENSMUSE00000110438 Chr11:75474401..75474514 No primer for this exon
downstream ENSMUSE00000297162 Chr11:75474599..75474670 No primer for this exon
downstream ENSMUSE00000110423 Chr11:75474997..75475116 No primer for this exon
downstream ENSMUSE00000110416 Chr11:75475236..75475318 No primer for this exon
downstream ENSMUSE00000297144 Chr11:75475524..75475629 No primer for this exon
downstream ENSMUSE00000578394 Chr11:75475737..75475817 No primer for this exon
downstream ENSMUSE00000110425 Chr11:75476074..75476165 No primer for this exon
downstream ENSMUSE00000110414 Chr11:75479020..75479114 No primer for this exon
downstream ENSMUSE00000578393 Chr11:75479195..75479241 No primer for this exon
downstream ENSMUSE00000110429 Chr11:75479339..75479419 No primer for this exon
downstream ENSMUSE00000110422 Chr11:75481683..75481788 No primer for this exon
downstream ENSMUSE00000110431 Chr11:75481912..75482029 No primer for this exon
downstream ENSMUSE00000110421 Chr11:75482510..75482623 No primer for this exon
downstream ENSMUSE00000110433 Chr11:75482700..75482776 No primer for this exon
downstream ENSMUSE00000110419 Chr11:75483283..75483351 No primer for this exon
downstream ENSMUSE00000110412 Chr11:75483449..75483533 No primer for this exon
downstream ENSMUSE00000110424 Chr11:75483633..75483792 No primer for this exon
downstream ENSMUSE00000110430 Chr11:75484045..75484128 No primer for this exon
downstream ENSMUSE00000110439 Chr11:75484695..75484788 No primer for this exon
downstream ENSMUSE00000110418 Chr11:75484882..75484937 No primer for this exon
downstream ENSMUSE00000110426 Chr11:75485089..75485224 No primer for this exon
downstream ENSMUSE00000508959 Chr11:75485307..75485377 No primer for this exon
downstream ENSMUSE00000507179 Chr11:75485460..75485557 No primer for this exon
downstream ENSMUSE00000661772 Chr11:75485654..75485753 No primer for this exon
downstream ENSMUSE00000650622 Chr11:75486112..75488134 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTAATCGCCTTGCAGCAC Chr11:75465216..75465236 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGATCGTGACTGGGAAAA Chr11:75465213..75465233 61.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017774