Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29625
Trapped Gene
Ak5 (ENSMUSG00000039058)
Vector Insertion
Chr 3: 152278821 - 152316453
Public Clones E133A05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000566622 (Chr3:152316339..152316452 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATGCAAATACCCGATGAA Chr3:152316402..152316421 59.89 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000566622 (Chr3:152316339..152316452 -)
Downstram Exon
ENSMUSE00000635179 (Chr3:152278822..152279013 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATGCAAATACCCGATGAA Chr3:152316402..152316421 59.89 40 CGCACGCTTCTGTAACCTCT Chr3:152278917..152278936 60.59 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000586160 Chr3:152330764..152331104 TACAGCCATGAACACCAACG Chr3:152330811..152330830 60.57 50
upstream ENSMUSE00000566625 Chr3:152323480..152323666 AGACGTTACCGCCCCTAAAT Chr3:152323514..152323533 59.86 50
upstream ENSMUSE00000635180 Chr3:152318833..152319000 ACTAGACCTCGGCCCAAAAT Chr3:152318847..152318866 59.96 50
upstream ENSMUSE00000566623 Chr3:152316539..152316708 AATTGCAGAGCGGTATGGAT Chr3:152316652..152316671 59.56 45
upstream ENSMUSE00000566622 Chr3:152316339..152316452 TGATGCAAATACCCGATGAA Chr3:152316402..152316421 59.89 40
upstream ENSMUSE00000635179 Chr3:152278822..152279013 CCAAGAGAAGGGACTCATCG Chr3:152278827..152278846 59.8 55

*** Putative Vector Insertion (Chr 3: 152278821 - 152316453) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000258805 Chr3:152196319..152196409 TGGAACACTGCGTCTTCATC Chr3:152196353..152196372 59.84 50
downstream ENSMUSE00000258798 Chr3:152189682..152189758 ACATCATGGAAGGGTCAAGG Chr3:152189707..152189726 59.78 50
downstream ENSMUSE00000258793 Chr3:152166813..152166855 TCCCTCTGTGTCTTCTCCAAA Chr3:152166792..152166812 59.83 47.62
downstream ENSMUSE00000501011 Chr3:152162275..152162319 No primer for this exon
downstream ENSMUSE00000258782 Chr3:152144502..152144665 CTCCATGATGTCACGGATCA Chr3:152144501..152144520 60.5 50
downstream ENSMUSE00000258844 Chr3:152141305..152141421 GTAGCCGTCAATCAGGAAGC Chr3:152141322..152141341 59.84 55
downstream ENSMUSE00000258840 Chr3:152135721..152135912 AGGCGGTTAGTCATGGTGTC Chr3:152135829..152135848 60 55
downstream ENSMUSE00000586159 Chr3:152125779..152126980 TGCATTTACTCACGGAGCAG Chr3:152125987..152126006 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTGCATATTGTTTGGCAGA Chr3:152313415..152313435 60.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAATGTTTTGGAAGTCTGG Chr3:152313479..152313500 58.54 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039058