Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29628
Trapped Gene
Lasp1 (ENSMUSG00000038366)
Vector Insertion
Chr 11: 97661177 - 97668138
Public Clones (sanger) (sanger) (sanger) (sanger) D050E08 (ggtc) D098H07 (ggtc)
D057F02 (ggtc) D077E10 (ggtc) D050E08 (ggtc) E132G08 (ggtc) (ggtc)
D077E10 (ggtc) (cmhd) IST12567D4 (tigm) IST15100E7 (tigm) IST10019D9 (tigm)
IST12586G7 (tigm) IST10594B3 (tigm) IST10019D9 (tigm) IST13660F5 (tigm)
IST12455E11 (tigm) IST10594B3 (tigm) IST14150E6 (tigm) IST10761F8 (tigm)
IST11740H3 (tigm) IST14330B8 (tigm) IST12567D4 (tigm) IST10691F9 (tigm)
IST10275F5 (tigm) IST13245G7 (tigm) IST10691F9 (tigm) IST14112E1 (tigm)
IST10099E12 (tigm) IST11730F9 (tigm) IST10275F5 (tigm) IST11820B11 (tigm)
IST13245G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673695 (Chr11:97660983..97661176 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673695 (Chr11:97660983..97661176 +)
Downstram Exon
ENSMUSE00000285055 (Chr11:97668139..97668233 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50 AGGTCTCGCAGTGAAAGCAT Chr11:97668175..97668194 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673695 Chr11:97660983..97661176 CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50
upstream ENSMUSE00000347026 Chr11:97660986..97661176 CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50
upstream ENSMUSE00000673683 Chr11:97660989..97661176 CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50

*** Putative Vector Insertion (Chr 11: 97661177 - 97668138) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000285055 Chr11:97668139..97668233 AGGTCTCGCAGTGAAAGCAT Chr11:97668175..97668194 60.02 50
downstream ENSMUSE00000673680 Chr11:97668139..97668243 ACGCATTGCAGTAAGGCTTC Chr11:97668238..97668257 60.42 50
downstream ENSMUSE00000673691 Chr11:97668139..97668233 AGGTCTCGCAGTGAAAGCAT Chr11:97668175..97668194 60.02 50
downstream ENSMUSE00000285046 Chr11:97677012..97677096 AGCTCGCTCTGTTGCTTGAG Chr11:97677089..97677108 61.02 55
downstream ENSMUSE00000673679 Chr11:97677021..97677096 ACTCTGCAGCTCGCTCTGTT Chr11:97677096..97677115 60.5 55
downstream ENSMUSE00000505619 Chr11:97686156..97686263 TCTGGTCCTGGGTCTTCTTG Chr11:97686258..97686277 60.23 55
downstream ENSMUSE00000673676 Chr11:97686156..97686234 No primer for this exon
downstream ENSMUSE00000673674 Chr11:97694738..97695016 ACTGGTCGGGATATGGTGAG Chr11:97695012..97695031 59.8 55
downstream ENSMUSE00000718694 Chr11:97694860..97695016 ACTGGTCGGGATATGGTGAG Chr11:97695012..97695031 59.8 55
downstream ENSMUSE00000722091 Chr11:97694860..97695016 ACTGGTCGGGATATGGTGAG Chr11:97695012..97695031 59.8 55
downstream ENSMUSE00000285023 Chr11:97695398..97695501 CCACCATAGGACGAGGTCAT Chr11:97695446..97695465 59.8 55
downstream ENSMUSE00000673673 Chr11:97695398..97695698 CCACCATAGGACGAGGTCAT Chr11:97695446..97695465 59.8 55
downstream ENSMUSE00000673689 Chr11:97695398..97695501 CCACCATAGGACGAGGTCAT Chr11:97695446..97695465 59.8 55
downstream ENSMUSE00000356471 Chr11:97697386..97700076 CCTCAGACACGACGACAGAA Chr11:97698772..97698791 60.02 55
downstream ENSMUSE00000673686 Chr11:97697386..97699291 CCTCAGACACGACGACAGAA Chr11:97698772..97698791 60.02 55
downstream ENSMUSE00000673684 Chr11:97700028..97700076 No primer for this exon
downstream ENSMUSE00000673675 Chr11:97736253..97736277 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATAAGGTGAGCTCGGGTA Chr11:97664171..97664191 59.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCGTGACTGGGAAAACC Chr11:97664224..97664244 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038366