Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29633
Trapped Gene
Tanc1 (ENSMUSG00000035168)
Vector Insertion
Chr 2: 59580990 - 59596521
Public Clones (sanger) E132C03 (ggtc) D102H09 (ggtc) IST12482B7 (tigm) IST12949E2 (tigm)
IST10753H5 (tigm) IST10029C3 (tigm) IST10991B8 (tigm) IST14100C7 (tigm)
IST11584F2 (tigm) IST14011H8 (tigm) IST14282D6 (tigm) IST14433D6 (tigm)
IST14362C3 (tigm) IST13431H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433766 (Chr2:59580859..59580989 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCATTCTCGGCAGTGACA Chr2:59580949..59580968 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433766 (Chr2:59580859..59580989 +)
Downstram Exon
ENSMUSE00000566918 (Chr2:59596522..59596626 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCATTCTCGGCAGTGACA Chr2:59580949..59580968 59.98 50 CTTCTCCGAACGGGATCATA Chr2:59596599..59596618 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692281 Chr2:59450099..59450253 No primer for this exon
upstream ENSMUSE00000566920 Chr2:59450101..59450253 No primer for this exon
upstream ENSMUSE00000489031 Chr2:59484826..59484929 GACCACTGTACCGCGTTTCT Chr2:59484878..59484897 60.18 55
upstream ENSMUSE00000714716 Chr2:59537405..59537484 TGAAAATGCTGAAGGCTGTG Chr2:59537419..59537438 59.99 45
upstream ENSMUSE00000715765 Chr2:59537405..59537484 TGAAAATGCTGAAGGCTGTG Chr2:59537419..59537438 59.99 45
upstream ENSMUSE00000495924 Chr2:59562718..59562906 CTTTGCTGCCTCGACAATCT Chr2:59562850..59562869 60.54 50
upstream ENSMUSE00000692278 Chr2:59562718..59562906 CTTTGCTGCCTCGACAATCT Chr2:59562850..59562869 60.54 50
upstream ENSMUSE00000433766 Chr2:59580859..59580989 CTTCATTCTCGGCAGTGACA Chr2:59580949..59580968 59.98 50

*** Putative Vector Insertion (Chr 2: 59580990 - 59596521) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000566918 Chr2:59596522..59596626 CTTCTCCGAACGGGATCATA Chr2:59596599..59596618 60.03 50
downstream ENSMUSE00000709162 Chr2:59596522..59596626 CTTCTCCGAACGGGATCATA Chr2:59596599..59596618 60.03 50
downstream ENSMUSE00000718091 Chr2:59596522..59596626 CTTCTCCGAACGGGATCATA Chr2:59596599..59596618 60.03 50
downstream ENSMUSE00000355162 Chr2:59609189..59609319 AATCCCAGCCTTGTCAACAG Chr2:59609258..59609277 60.11 50
downstream ENSMUSE00000692273 Chr2:59609189..59609319 AATCCCAGCCTTGTCAACAG Chr2:59609258..59609277 60.11 50
downstream ENSMUSE00000411253 Chr2:59610410..59610596 TAATGGTCTCGCAGGGACTT Chr2:59610554..59610573 59.69 50
downstream ENSMUSE00000692272 Chr2:59610410..59610596 TAATGGTCTCGCAGGGACTT Chr2:59610554..59610573 59.69 50
downstream ENSMUSE00000251466 Chr2:59623381..59623644 CCACTCCGGTCATCATTTTC Chr2:59623423..59623442 60.32 50
downstream ENSMUSE00000692271 Chr2:59623381..59623644 CCACTCCGGTCATCATTTTC Chr2:59623423..59623442 60.32 50
downstream ENSMUSE00000251459 Chr2:59628833..59628955 GTATTGTGCCAGGGCAATCT Chr2:59628929..59628948 59.96 50
downstream ENSMUSE00000692270 Chr2:59628833..59628934 GTATTGTGCCAGGGCAATCT Chr2:59628929..59628948 59.96 50
downstream ENSMUSE00000251452 Chr2:59629656..59629937 GGTGACAAACTGGGACTGCT Chr2:59629935..59629954 60.16 55
downstream ENSMUSE00000692269 Chr2:59629656..59629937 GGTGACAAACTGGGACTGCT Chr2:59629935..59629954 60.16 55
downstream ENSMUSE00000251446 Chr2:59631153..59631304 CTCTCTCGGTCTCTGGCTGT Chr2:59631280..59631299 59.73 60
downstream ENSMUSE00000692268 Chr2:59631153..59631304 CTCTCTCGGTCTCTGGCTGT Chr2:59631280..59631299 59.73 60
downstream ENSMUSE00000251441 Chr2:59633852..59634083 AGGCTTGTAAGTGGCTCCAG Chr2:59634078..59634097 59.5 55
downstream ENSMUSE00000251435 Chr2:59635643..59635809 TCACGGTCACGATCAACTTC Chr2:59635798..59635817 59.68 50
downstream ENSMUSE00000251425 Chr2:59637628..59638235 CCATTCAGGGAGATGTTGCT Chr2:59637773..59637792 60.07 50
downstream ENSMUSE00000251417 Chr2:59644333..59644441 CCAGTAGAGCGTGTCCGTTC Chr2:59644355..59644374 60.85 60
downstream ENSMUSE00000251410 Chr2:59645624..59645746 TCTGTGCTGTAACCGATCCA Chr2:59645694..59645713 60.26 50
downstream ENSMUSE00000251405 Chr2:59653375..59653611 CCCCTTCTTGATGAGCAGAC Chr2:59653608..59653627 59.8 55
downstream ENSMUSE00000251400 Chr2:59655542..59655727 CACTGGCCCTTCTTATCCAA Chr2:59655573..59655592 60.07 50
downstream ENSMUSE00000333011 Chr2:59658264..59658342 GTTTCTCCCCACAACGTGTC Chr2:59658343..59658362 60.41 55
downstream ENSMUSE00000432881 Chr2:59658264..59659438 CCACACCACCATCTGTTCTG Chr2:59659168..59659187 60 55
downstream ENSMUSE00000251390 Chr2:59671193..59671326 CTCGCAGATCTCCACCTTTC Chr2:59671239..59671258 59.95 55
downstream ENSMUSE00000251386 Chr2:59672638..59672761 AGCCACCATGAGAGGTGTTC Chr2:59672718..59672737 60.12 55
downstream ENSMUSE00000251378 Chr2:59673449..59673624 AGTACGGCCGTTTTTGTCTG Chr2:59673588..59673607 60.17 50
downstream ENSMUSE00000251372 Chr2:59675143..59675275 TCTATCACGGCTCCCTTCTC Chr2:59675180..59675199 59.39 55
downstream ENSMUSE00000251364 Chr2:59677032..59677123 TCCTTCCTCTACCAATTTCTGC Chr2:59677109..59677130 59.72 45.46
downstream ENSMUSE00000251355 Chr2:59678996..59679142 AACTTCCGCAAGGCATACTG Chr2:59679051..59679070 60.27 50
downstream ENSMUSE00000251349 Chr2:59680067..59680167 TTGGGTTTCAATTCCAGAGC Chr2:59680122..59680141 60.05 45
downstream ENSMUSE00000432834 Chr2:59680752..59684206 GTGGGCTTCCGTACTGACAT Chr2:59682126..59682145 60 55
downstream ENSMUSE00000692265 Chr2:59680752..59683774 GTGGGCTTCCGTACTGACAT Chr2:59682126..59682145 60 55
downstream ENSMUSE00000645040 Chr2:59681296..59681325 No primer for this exon
downstream ENSMUSE00000645037 Chr2:59681374..59682180 GTGGGCTTCCGTACTGACAT Chr2:59682126..59682145 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTCTCTTTGGCCCATTA Chr2:59592976..59592996 59.12 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGTCTCTTTGGCCCATTA Chr2:59592976..59592996 59.12 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035168