Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29635
Trapped Gene
Tfdp1 (ENSMUSG00000038482)
Vector Insertion
Chr 8: 13373924 - 13377141
Public Clones E130E08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000272493 (Chr8:13373845..13373923 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCGTCACGACAACAGGTTC Chr8:13373874..13373893 59.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000272493 (Chr8:13373845..13373923 +)
Downstram Exon
ENSMUSE00000472934 (Chr8:13377142..13378446 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCGTCACGACAACAGGTTC Chr8:13373874..13373893 59.73 50 CAACTGTTGAGGGGCAAAAT Chr8:13377613..13377632 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610192 Chr8:13338806..13338920 No primer for this exon
upstream ENSMUSE00000469325 Chr8:13339665..13339739 TCTGTGGAGGGTACGCAGTT Chr8:13339680..13339699 60.71 55
upstream ENSMUSE00000455008 Chr8:13357043..13357109 No primer for this exon
upstream ENSMUSE00000455017 Chr8:13365089..13365195 TTCGGACAGTCCAATGTCAA Chr8:13365160..13365179 60.09 45
upstream ENSMUSE00000272558 Chr8:13369459..13369580 GACTCCTCACCTTGGTCTGC Chr8:13369558..13369577 59.84 60
upstream ENSMUSE00000514215 Chr8:13370481..13370646 CTGCCGACAACCACATTCTA Chr8:13370615..13370634 59.72 50
upstream ENSMUSE00000272546 Chr8:13370879..13371022 GCTCAGGAGTGCCAGAACTT Chr8:13370999..13371018 59.6 55
upstream ENSMUSE00000272513 Chr8:13371352..13371420 GGCTGGAGAGGATCAAACAG Chr8:13371368..13371387 59.8 55
upstream ENSMUSE00000272506 Chr8:13372466..13372617 TCATTGACTGCAGCATCTCC Chr8:13372590..13372609 59.95 50
upstream ENSMUSE00000272500 Chr8:13372936..13373102 CACGTTTGAGATCCACGATG Chr8:13372963..13372982 60.11 50
upstream ENSMUSE00000272493 Chr8:13373845..13373923 TTCGTCACGACAACAGGTTC Chr8:13373874..13373893 59.73 50

*** Putative Vector Insertion (Chr 8: 13373924 - 13377141) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000472934 Chr8:13377142..13378446 CAACTGTTGAGGGGCAAAAT Chr8:13377613..13377632 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAGCCTTACTGTGTTTCAG Chr8:13376945..13376966 59.93 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACATCCAATGGCACAAGG Chr8:13373894..13373914 59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038482