Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29651
Trapped Gene
Tbcel (ENSMUSG00000037287)
Vector Insertion
Chr 9: 42269356 - 42280310
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) D163G03 (ggtc) (ggtc) D081G04 (ggtc) E126E03 (ggtc)
D163G03 (ggtc) D163H05 (ggtc) D105B03 (ggtc) E126E03 (ggtc) IST14605A9 (tigm)
IST10458C2 (tigm) IST10551B11 (tigm) IST14155D11 (tigm) IST15024B12 (tigm)
IST14315C6 (tigm) IST14642D8 (tigm) IST14154G11 (tigm) IST11320C10 (tigm)
IST14953B7 (tigm) IST14953B6 (tigm) IST10544F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411778 (Chr9:42280149..42280309 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAGGGGTCGAGGTGAAGT Chr9:42280256..42280275 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411778 (Chr9:42280149..42280309 -)
Downstram Exon
ENSMUSE00000536146 (Chr9:42269357..42269485 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAGGGGTCGAGGTGAAGT Chr9:42280256..42280275 60.11 55 GTCTCCACGCCGAGATTAAC Chr9:42269386..42269405 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411778 Chr9:42280149..42280309 AGAAGGGGTCGAGGTGAAGT Chr9:42280256..42280275 60.11 55
upstream ENSMUSE00000536146 Chr9:42269357..42269485 ATCTCGGCGTGGAGACATAG Chr9:42269404..42269423 60.24 55

*** Putative Vector Insertion (Chr 9: 42269356 - 42280310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000584658 Chr9:42259696..42259845 CTTCTCCCACTAGGCTGGTC Chr9:42259784..42259803 58.89 60
downstream ENSMUSE00000584659 Chr9:42259696..42259845 CTTCTCCCACTAGGCTGGTC Chr9:42259784..42259803 58.89 60
downstream ENSMUSE00000403463 Chr9:42258007..42258146 TCGAGTTCTGACACGTGAGC Chr9:42258019..42258038 60.19 55
downstream ENSMUSE00000269012 Chr9:42252490..42252671 CAGAGAAGGACCCAGCACAT Chr9:42252544..42252563 60.26 55
downstream ENSMUSE00000268988 Chr9:42250902..42251158 GACCGCAGATTAGGGAACAA Chr9:42250900..42250919 60.07 50
downstream ENSMUSE00000268968 Chr9:42247180..42247306 CTTCAAGCTTGGGGAATGAA Chr9:42247231..42247250 60.18 45
downstream ENSMUSE00000268947 Chr9:42245198..42245314 CTCACCATCCGTCACAACAC Chr9:42245244..42245263 60.01 55
downstream ENSMUSE00000707268 Chr9:42221501..42224232 TCCACGGGGGACATAAAATA Chr9:42222667..42222686 60.01 45
downstream ENSMUSE00000509751 Chr9:42220400..42224232 TCCACGGGGGACATAAAATA Chr9:42222667..42222686 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCTCTCCAATCCACTTGC Chr9:42274331..42274351 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAATCCACTTGCTTTTCA Chr9:42274325..42274345 59.25 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037287