Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29658
Trapped Gene
Ppme1 (ENSMUSG00000030718)
Vector Insertion
Chr 7: 107503777 - 107520407
Public Clones E124G08 (ggtc) E124G08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520942 (Chr7:107520233..107520406 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGTTGTACTGCACGTATCG Chr7:107520380..107520399 60.19 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520942 (Chr7:107520233..107520406 -)
Downstram Exon
ENSMUSE00000202312 (Chr7:107503778..107503871 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGTTGTACTGCACGTATCG Chr7:107520380..107520399 60.19 55 ATGGGACAGGGGTAAAGTCC Chr7:107503815..107503834 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000520942 Chr7:107520233..107520406 CGGTTGTACTGCACGTATCG Chr7:107520380..107520399 60.19 55
upstream ENSMUSE00000202312 Chr7:107503778..107503871 GGAGAATGAAACTGGCAAGG Chr7:107503780..107503799 59.67 50

*** Putative Vector Insertion (Chr 7: 107503777 - 107520407) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000202298 Chr7:107503219..107503311 CAGGACTGGACCCTCAGAAC Chr7:107503248..107503267 59.68 60
downstream ENSMUSE00000202308 Chr7:107496632..107496689 TCCAGAGCCACAATCCTACA Chr7:107496624..107496643 59.24 50
downstream ENSMUSE00000202295 Chr7:107496315..107496366 TTGCCATTGTTTCTGCTGAC Chr7:107496294..107496313 59.85 45
downstream ENSMUSE00000202288 Chr7:107493462..107493616 CAATCAGCATGACTGGAGGA Chr7:107493533..107493552 59.79 50
downstream ENSMUSE00000202315 Chr7:107490356..107490446 TTTTAGGTCGACCACGCAAG Chr7:107490368..107490387 61.18 50
downstream ENSMUSE00000202292 Chr7:107489541..107489606 ATACACGGGCAGACTCAAGG Chr7:107489541..107489560 60.13 55
downstream ENSMUSE00000202279 Chr7:107486880..107487003 TGGATTTGGAACCTTCTGGA Chr7:107486944..107486963 60.43 45
downstream ENSMUSE00000202310 Chr7:107483558..107483687 CCAGGTGTATGGGTGATCCT Chr7:107483639..107483658 59.65 55
downstream ENSMUSE00000202280 Chr7:107482438..107482482 No primer for this exon
downstream ENSMUSE00000202285 Chr7:107480368..107480432 CACTGGGGTAAGACCTGCAT Chr7:107480380..107480399 59.99 55
downstream ENSMUSE00000202314 Chr7:107477545..107477612 AGGAAAGTGGCAACAGCTTC Chr7:107477565..107477584 59.48 50
downstream ENSMUSE00000633412 Chr7:107475248..107476392 AGGTCACTAGCAGCCAGGAA Chr7:107476346..107476365 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTCTCAGGCTGGCTCTA Chr7:107517390..107517410 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGAGCACGTGACTGGGAAA Chr7:107508343..107508363 59.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030718