Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29663
Trapped Gene
Nipsnap1 (ENSMUSG00000034285)
Vector Insertion
Chr 11: 4774107 - 4782971
Public Clones (sanger) (sanger) E123F02 (ggtc) (ggtc) E123F02 (ggtc) IST12739H9 (tigm)
IST12016H1 (tigm) IST13652G11 (tigm) IST11387G6 (tigm) IST12016H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406462 (Chr11:4774006..4774106 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTATTCACGAAGCCGAGAC Chr11:4774050..4774069 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406462 (Chr11:4774006..4774106 +)
Downstram Exon
ENSMUSE00000581372 (Chr11:4782972..4783174 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTATTCACGAAGCCGAGAC Chr11:4774050..4774069 59.99 55 AGGACAAATCGGAGAACAGC Chr11:4783151..4783170 59.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406462 Chr11:4774006..4774106 GCTATTCACGAAGCCGAGAC Chr11:4774050..4774069 59.99 55

*** Putative Vector Insertion (Chr 11: 4774107 - 4782971) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581372 Chr11:4782972..4783174 AGGACAAATCGGAGAACAGC Chr11:4783151..4783170 59.29 50
downstream ENSMUSE00000581370 Chr11:4783222..4783256 GCAGGAGCTTCCTAAGCAAC Chr11:4783251..4783270 59.22 55
downstream ENSMUSE00000307937 Chr11:4783371..4783498 TTGGACAGCAGAGTGGAGTG Chr11:4783469..4783488 60.02 55
downstream ENSMUSE00000307927 Chr11:4783729..4783774 TGTAGGCATCCAGACATTCG Chr11:4783767..4783786 59.67 50
downstream ENSMUSE00000307918 Chr11:4784025..4784119 CGTACCACGTGTTCCAGTTG Chr11:4784104..4784123 60.06 55
downstream ENSMUSE00000307909 Chr11:4788883..4788953 CTGAGAACCGCCATAGGTGT Chr11:4788906..4788925 60.13 55
downstream ENSMUSE00000715271 Chr11:4789100..4789240 ACTGGTTTCTCCTGGACAGC Chr11:4789160..4789179 59.31 55
downstream ENSMUSE00000718600 Chr11:4789100..4789240 ACTGGTTTCTCCTGGACAGC Chr11:4789160..4789179 59.31 55
downstream ENSMUSE00000656061 Chr11:4789536..4789567 CCCATTCAATCATGGTTCCT Chr11:4789560..4789579 59.6 45
downstream ENSMUSE00000656070 Chr11:4789536..4789567 CCCATTCAATCATGGTTCCT Chr11:4789560..4789579 59.6 45
downstream ENSMUSE00000656058 Chr11:4789895..4789989 TCTCCTGACGGTACTTGATGG Chr11:4789925..4789945 60.12 52.38
downstream ENSMUSE00000656069 Chr11:4789895..4789989 TCTCCTGACGGTACTTGATGG Chr11:4789925..4789945 60.12 52.38
downstream ENSMUSE00000656056 Chr11:4791406..4791489 TTCGAGTCTCCTCCCGAGAT Chr11:4791444..4791463 61.27 55
downstream ENSMUSE00000656068 Chr11:4791406..4791489 TTCGAGTCTCCTCCCGAGAT Chr11:4791444..4791463 61.27 55
downstream ENSMUSE00000307866 Chr11:4793123..4794203 TTGTCGAAGCTGAACACCAC Chr11:4793321..4793340 59.88 50
downstream ENSMUSE00000595105 Chr11:4793123..4794203 TTGTCGAAGCTGAACACCAC Chr11:4793321..4793340 59.88 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGGAGCAGGGGAGGTAAT Chr11:4780142..4780162 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000034285