Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29665
Trapped Gene
Eif2s3x (ENSMUSG00000035150)
Vector Insertion
Chr X: 91457057 - 91457991
Public Clones E123E09 (ggtc) IST10917D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361268 (ChrX:91457904..91457990 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCTTTCCCGACAGGATCT ChrX:91457914..91457933 59.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361268 (ChrX:91457904..91457990 -)
Downstram Exon
ENSMUSE00000550137 (ChrX:91457058..91457121 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCTTTCCCGACAGGATCT ChrX:91457914..91457933 59.09 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361268 ChrX:91457904..91457990 CATCTTTCCCGACAGGATCT ChrX:91457914..91457933 59.09 50
upstream ENSMUSE00000709653 ChrX:91457904..91457990 CATCTTTCCCGACAGGATCT ChrX:91457914..91457933 59.09 50
upstream ENSMUSE00000550137 ChrX:91457058..91457121 No primer for this exon

*** Putative Vector Insertion (Chr X: 91457057 - 91457991) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000393550 ChrX:91454875..91455002 TTCCCATGAGCTACGTGACC ChrX:91454953..91454972 61.07 55
downstream ENSMUSE00000550131 ChrX:91454668..91454789 AAACTCATCTGGTGTGCTGCT ChrX:91454690..91454710 59.93 47.62
downstream ENSMUSE00000407988 ChrX:91450388..91450482 TCAGCATCGTAGCCATCAAA ChrX:91450405..91450424 60.37 45
downstream ENSMUSE00000550126 ChrX:91449289..91449447 AAATGCGAGGATTTGCTCAT ChrX:91449274..91449293 59.67 40
downstream ENSMUSE00000550122 ChrX:91448153..91448287 GGGGGCACTGGTATTTTCTT ChrX:91448163..91448182 60.19 50
downstream ENSMUSE00000550121 ChrX:91446229..91446323 CACCTCCCTTAAGGTCATCG ChrX:91446242..91446261 59.54 55
downstream ENSMUSE00000550119 ChrX:91445053..91445197 TGGAGACAATACCGGGTCTC ChrX:91445136..91445155 59.93 55
downstream ENSMUSE00000697454 ChrX:91444980..91445197 TGGAGACAATACCGGGTCTC ChrX:91445136..91445155 59.93 55
downstream ENSMUSE00000300442 ChrX:91442627..91442796 GGAAATCTCCAGTTCGGTGA ChrX:91442665..91442684 60.05 50
downstream ENSMUSE00000550115 ChrX:91441611..91441783 TGTCGACAGGGAGCCTATGT ChrX:91441705..91441724 60.68 55
downstream ENSMUSE00000362509 ChrX:91434055..91436261 GGAATGGGCACACAACTTCT ChrX:91434702..91434721 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTCTCGTAATCGCCTTGC ChrX:91457928..91457948 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCTTTTCTCTCCGAGCA ChrX:91457973..91457993 60.07 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035150