Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29669
Trapped Gene
AK122525 (ENSMUSG00000038214)
Vector Insertion
Chr 10: 43199179 - 43213447
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
E122G06 (ggtc) E041E08 (ggtc) (ggtc) E091E11 (ggtc) D183D07 (ggtc)
(ggtc) E062F06 (ggtc) D161F08 (ggtc) (ggtc) E122G06 (ggtc) E022E08 (ggtc)
(ggtc) E091E11 (ggtc) D183D07 (ggtc) 5SE287A11 (ggtc) (ggtc)
E041E08 (ggtc) (ggtc) E091F12 (ggtc) E022E08 (ggtc) (ggtc)
E079F02 (ggtc) D161F08 (ggtc) 3SE287A11 (ggtc) IST14958B12 (tigm) IST14578B9 (tigm)
IST14602D1 (tigm) IST13235H7 (tigm) IST14267A2 (tigm) IST14541D7 (tigm)
IST14442C4 (tigm) IST14482E4 (tigm) IST11683F4 (tigm) IST10070F10 (tigm)
IST14208G4 (tigm) IST14114C2 (tigm) IST14200C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000496671 (Chr10:43198946..43199178 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCTCCGCAAAGTAACAACT Chr10:43199149..43199168 60.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000496671 (Chr10:43198946..43199178 +)
Downstram Exon
ENSMUSE00000497694 (Chr10:43213448..43213495 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCTCCGCAAAGTAACAACT Chr10:43199149..43199168 60.44 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496671 Chr10:43198946..43199178 CGCTCCGCAAAGTAACAACT Chr10:43199149..43199168 60.44 50

*** Putative Vector Insertion (Chr 10: 43199179 - 43213447) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000497694 Chr10:43213448..43213495 No primer for this exon
downstream ENSMUSE00000458897 Chr10:43213952..43214148 CTGCCTTCACGGGGTTATTT Chr10:43213981..43214000 61.22 50
downstream ENSMUSE00000508545 Chr10:43229653..43233622 CGCTACTGGAGTTTGCCTTC Chr10:43229905..43229924 60.01 55
downstream ENSMUSE00000511401 Chr10:43233769..43235202 ACGGCCACATGAATAAAAGC Chr10:43234566..43234585 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACAACTCTCGTCCCAGGTG Chr10:43202163..43202183 60.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAACTCTCGTCCCAGGTG Chr10:43202163..43202183 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038214