Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29673
Trapped Gene
Comtd1 (ENSMUSG00000021773)
Vector Insertion
Chr 14: 22667223 - 22667538
Public Clones E121G03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230122 (Chr14:22667432..22667537 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGATTCCATGATGACCTGT Chr14:22667496..22667515 59.59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230122 (Chr14:22667432..22667537 -)
Downstram Exon
ENSMUSE00000230116 (Chr14:22667224..22667342 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGATTCCATGATGACCTGT Chr14:22667496..22667515 59.59 50 CCGAGTAGCCCGTGAAAGTA Chr14:22667300..22667319 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423812 Chr14:22668001..22668129 TCGCTACTGGTCTCTTGCTG Chr14:22668002..22668021 59.34 55
upstream ENSMUSE00000479091 Chr14:22667763..22667890 ACCTGAGGACAATCCCCTGT Chr14:22667822..22667841 60.77 55
upstream ENSMUSE00000230122 Chr14:22667432..22667537 GGGATTCCATGATGACCTGT Chr14:22667496..22667515 59.59 50
upstream ENSMUSE00000230116 Chr14:22667224..22667342 No primer for this exon

*** Putative Vector Insertion (Chr 14: 22667223 - 22667538) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000120749 Chr14:22667095..22667149 AAGGTCGATCTTCTGCTCCA Chr14:22667101..22667120 59.95 50
downstream ENSMUSE00000120743 Chr14:22666836..22666969 TGCAGACAGCGCTCGTAGTA Chr14:22666851..22666870 60.91 55
downstream ENSMUSE00000345498 Chr14:22666403..22666649 GTTCCGCACACATTCAACAG Chr14:22666562..22666581 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGATTCCATGATGACCTGT Chr14:22667494..22667514 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGATTCCATGATGACCTGT Chr14:22667494..22667514 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021773