Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29680
Trapped Gene
Lsm14a (ENSMUSG00000066568)
Vector Insertion
Chr 7: 35138683 - 35142516
Public Clones E119F04 (ggtc) E119F04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719430 (Chr7:35142453..35142515 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGCCAGAAAATGAGCAAC Chr7:35142477..35142496 59.32 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719430 (Chr7:35142453..35142515 -)
Downstram Exon
ENSMUSE00000533527 (Chr7:35138684..35138866 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGCCAGAAAATGAGCAAC Chr7:35142477..35142496 59.32 45 ACCATCTCGACGGATACCAA Chr7:35138762..35138781 60.34 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000533543 Chr7:35174377..35174559 ATCGACACCGAGAACTCCAC Chr7:35174394..35174413 60.12 55
upstream ENSMUSE00000675464 Chr7:35160617..35160629 No primer for this exon
upstream ENSMUSE00000533541 Chr7:35160248..35160411 CAGACCAACAGATCGTCCAA Chr7:35160370..35160389 59.68 50
upstream ENSMUSE00000533539 Chr7:35156074..35156203 GGTGGGTTCCTATGGACCTT Chr7:35156149..35156168 60.05 55
upstream ENSMUSE00000533537 Chr7:35150634..35150756 GGCCTTCACACAAGACACAA Chr7:35150661..35150680 59.73 50
upstream ENSMUSE00000533535 Chr7:35142785..35142961 AGTCCAACCATGGAACAAGC Chr7:35142907..35142926 59.97 50
upstream ENSMUSE00000719430 Chr7:35142453..35142515 AAGGCCAGAAAATGAGCAAC Chr7:35142477..35142496 59.32 45
upstream ENSMUSE00000721241 Chr7:35142453..35142515 AAGGCCAGAAAATGAGCAAC Chr7:35142477..35142496 59.32 45
upstream ENSMUSE00000533527 Chr7:35138684..35138866 TTGGTATCCGTCGAGATGGT Chr7:35138784..35138803 60.34 50
upstream ENSMUSE00000675462 Chr7:35138684..35138866 TTGGTATCCGTCGAGATGGT Chr7:35138784..35138803 60.34 50

*** Putative Vector Insertion (Chr 7: 35138683 - 35142516) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675461 Chr7:35138409..35138580 AGGGGATCTTCCTCATCAGC Chr7:35138453..35138472 60.56 55
downstream ENSMUSE00000712206 Chr7:35138409..35138580 AGGGGATCTTCCTCATCAGC Chr7:35138453..35138472 60.56 55
downstream ENSMUSE00000718902 Chr7:35138409..35138580 AGGGGATCTTCCTCATCAGC Chr7:35138453..35138472 60.56 55
downstream ENSMUSE00000533521 Chr7:35136305..35136536 AAACTCCCTACCACCACGAG Chr7:35136301..35136320 59.06 55
downstream ENSMUSE00000675466 Chr7:35136305..35136536 AAACTCCCTACCACCACGAG Chr7:35136301..35136320 59.06 55
downstream ENSMUSE00000533517 Chr7:35132945..35133001 TCCAGACCTTTTAGGGTCCA Chr7:35132946..35132965 59.52 50
downstream ENSMUSE00000675465 Chr7:35132945..35133001 TCCAGACCTTTTAGGGTCCA Chr7:35132946..35132965 59.52 50
downstream ENSMUSE00000533514 Chr7:35129738..35130977 GGTGCCAGAGGATTCTGAAA Chr7:35129821..35129840 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:35139445..35139465 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000066568