Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29681
Trapped Gene
Gnao1 (ENSMUSG00000031748)
Vector Insertion
Chr 8: 96420273 - 96468097
Public Clones E119C03 (ggtc) D131F01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000299435 (Chr8:96420131..96420272 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGGAAGACGTGAAGCAGTA Chr8:96420156..96420175 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000299435 (Chr8:96420131..96420272 +)
Downstram Exon
ENSMUSE00000299425 (Chr8:96468098..96468258 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGGAAGACGTGAAGCAGTA Chr8:96420156..96420175 60.26 55 GACTCACCACGTCACACACC Chr8:96468134..96468153 60.05 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409274 Chr8:96334738..96335353 AGCAAGGCGATTGAGAAAAA Chr8:96335281..96335300 59.96 40
upstream ENSMUSE00000580961 Chr8:96335551..96335593 AAAAGCACCATTGTGAAGCA Chr8:96335568..96335587 59.32 40
upstream ENSMUSE00000299435 Chr8:96420131..96420272 GGGGAAGACGTGAAGCAGTA Chr8:96420156..96420175 60.26 55

*** Putative Vector Insertion (Chr 8: 96420273 - 96468097) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000299425 Chr8:96468098..96468258 GACTCACCACGTCACACACC Chr8:96468134..96468153 60.05 60
downstream ENSMUSE00000212654 Chr8:96473304..96473432 TTGACTCTGGTTCGGAGGAT Chr8:96473384..96473403 59.65 50
downstream ENSMUSE00000212652 Chr8:96474202..96474331 GCTGAGTGCGACACAGAAGA Chr8:96474298..96474317 60.34 55
downstream ENSMUSE00000580956 Chr8:96477875..96478028 GGTGAGTGGGGACTTCTTGA Chr8:96478009..96478028 60.09 55
downstream ENSMUSE00000485367 Chr8:96479965..96480152 CGTAGGTTTTTGGCGATGAT Chr8:96480136..96480155 59.96 45
downstream ENSMUSE00000580960 Chr8:96487284..96487437 GGGTATTCGGGAAAGCAGAT Chr8:96487438..96487457 60.29 50
downstream ENSMUSE00000405696 Chr8:96490768..96490983 GCAATGATGATGTCGGTGAC Chr8:96490927..96490946 59.93 50
downstream ENSMUSE00000357515 Chr8:96491932..96493287 AGGTTAGACAGGGGCTTGGT Chr8:96492037..96492056 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTGGAGGACAGGGGTAT Chr8:96444274..96444294 60.24 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGTGGAGGACAGGGGTAT Chr8:96444274..96444294 60.24 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031748