Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29695
Trapped Gene
Add1 (ENSMUSG00000029106)
Vector Insertion
Chr 5: 34917274 - 34938217
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
E036E12 (ggtc) D052F08 (ggtc) 3SE386D02 (ggtc) (ggtc) D163A05 (ggtc)
(ggtc) E061C09 (ggtc) D056G05 (ggtc) 3SE289G03 (ggtc) (ggtc)
E028E09 (ggtc) E114G12 (ggtc) D123B10 (ggtc) (ggtc) E036E12 (ggtc)
D052F08 (ggtc) 3SE386E02 (ggtc) (ggtc) D163A05 (ggtc) (ggtc)
E112E02 (ggtc) D065H04 (ggtc) (ggtc) CMHD-GT_540G5-5S (cmhd) IST12294D8 (tigm)
IST14579F12 (tigm) IST11059G1 (tigm) IST14062B2 (tigm) IST14169H5 (tigm)
IST14543F10 (tigm) IST14630C12 (tigm) IST14942H6 (tigm) IST11188G1 (tigm)
IST11485D5 (tigm) IST13150G2 (tigm) IST10951B10 (tigm) IST10472H5 (tigm)
IST14225F9 (tigm) IST11073G2 (tigm) IST10837G11 (tigm) IST13246F8 (tigm)
IST11593E8 (tigm) IST14303B7 (tigm) IST12377H8 (tigm) IST12420B11 (tigm)
IST14180G11 (tigm) IST10296B3 (tigm) IST11026B9 (tigm) IST14923F7 (tigm)
IST14276G12 (tigm) IST12286G2 (tigm) IST12435G3 (tigm) IST12294D8 (tigm)
IST14678E1 (tigm) IST14886G6 (tigm) IST13261H6 (tigm) IST14424E5 (tigm)
IST13612E9 (tigm) IST12435G3 (tigm) IST11073G2 (tigm) IST14234G11 (tigm)
IST11739H8 (tigm) IST10482D2 (tigm) IST13660B2 (tigm) IST11485D5 (tigm)
IST14625G5 (tigm) IST11604F5 (tigm) IST15021D9 (tigm) IST13213A8 (tigm)
IST11754A4 (tigm) IST13885G11 (tigm) IST14789B12 (tigm) IST14641F10 (tigm)
IST13246F8 (tigm) IST14923F7 (tigm) IST11973G8 (tigm) IST13741F3 (tigm)
IST14632H6 (tigm) IST12122H3 (tigm) IST11535D12 (tigm) IST11548G6 (tigm)
IST14196A9 (tigm) IST12122H3 (tigm) IST13126H5 (tigm) IST14529H9 (tigm)
IST13741F3 (tigm) IST12420A11 (tigm) IST14569H8 (tigm) IST14405D10 (tigm)
IST15011C8 (tigm) IST11237E1 (tigm) IST12860B8 (tigm) IST14559E4 (tigm)
IST10287H11 (tigm) IST13403A4 (tigm) IST10897C11 (tigm) IST11059G1 (tigm)
IST14864B10 (tigm) IST15064C10 (tigm) IST14180G11 (tigm) IST15056B2 (tigm)
IST14881A8 (tigm) IST14375C9 (tigm) IST14137G5 (tigm) IST14564H7 (tigm)
IST14669D4 (tigm) IST14657H1 (tigm) IST11177F11 (tigm) IST14226F2 (tigm)
IST14226E1 (tigm) IST12377H7 (tigm) IST11138B4 (tigm) IST12420A11 (tigm)
IST11542F7 (tigm) IST12138F3 (tigm) IST14886G6 (tigm) IST11026B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698963 (Chr5:34916691..34917273 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTTCACCTGAAACTGCTG Chr5:34917186..34917205 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698963 (Chr5:34916691..34917273 +)
Downstram Exon
ENSMUSE00000698962 (Chr5:34938218..34938354 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTTCACCTGAAACTGCTG Chr5:34917186..34917205 59.87 50 TCCTCAGGCTGCTAAGAACC Chr5:34938334..34938353 59.57 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699018 Chr5:34916461..34916562 GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60
upstream ENSMUSE00000418981 Chr5:34916512..34916562 GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60
upstream ENSMUSE00000698963 Chr5:34916691..34917273 TGGTTCACCTGAAACTGCTG Chr5:34917186..34917205 59.87 50

*** Putative Vector Insertion (Chr 5: 34917274 - 34938217) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000698962 Chr5:34938218..34938354 TCCTCAGGCTGCTAAGAACC Chr5:34938334..34938353 59.57 55
downstream ENSMUSE00000600629 Chr5:34943973..34944187 CCGAGTGTCACCATTCATTG Chr5:34944013..34944032 59.96 50
downstream ENSMUSE00000708931 Chr5:34943973..34944187 CCGAGTGTCACCATTCATTG Chr5:34944013..34944032 59.96 50
downstream ENSMUSE00000600643 Chr5:34943991..34944187 ATGTTCCTCTCCCGCAAATA Chr5:34944117..34944136 59.53 45
downstream ENSMUSE00000654143 Chr5:34947339..34947501 CTCGCAGTCATGAAATCTGC Chr5:34947448..34947467 59.55 50
downstream ENSMUSE00000654142 Chr5:34948477..34948628 GCGATAGAATCCGACCCTCT Chr5:34948531..34948550 60.57 55
downstream ENSMUSE00000654141 Chr5:34952841..34952921 GAGGAAGTGTTCCTGCTCAGA Chr5:34952875..34952895 59.59 52.38
downstream ENSMUSE00000654139 Chr5:34953139..34953288 CATACACTGCCGAGTGCAGA Chr5:34953235..34953254 61.04 55
downstream ENSMUSE00000654138 Chr5:34955937..34956080 GGGGAGATAGGCAAGAGTCC Chr5:34955977..34955996 60.04 60
downstream ENSMUSE00000654137 Chr5:34956168..34956266 CACGCTCTCTCCAACTGACA Chr5:34956218..34956237 60.18 55
downstream ENSMUSE00000654134 Chr5:34956833..34957009 GAACGGGATTTGGCTTTGTA Chr5:34956915..34956934 59.94 45
downstream ENSMUSE00000654131 Chr5:34959212..34959463 TCTTCGACTTGGGACTGCTT Chr5:34959461..34959480 59.99 50
downstream ENSMUSE00000698966 Chr5:34959212..34959556 TCTTCGACTTGGGACTGCTT Chr5:34959461..34959480 59.99 50
downstream ENSMUSE00000654126 Chr5:34961999..34962100 GGTTAGGGACAGCAGAGGTG Chr5:34962050..34962069 59.72 60
downstream ENSMUSE00000654124 Chr5:34962694..34962783 ACTGAGGTCCTGCCGTCTTA Chr5:34962742..34962761 59.87 55
downstream ENSMUSE00000698961 Chr5:34963481..34963567 GCCCTTCGATAGTTTCCGTA Chr5:34963523..34963542 59.18 50
downstream ENSMUSE00000654122 Chr5:34967928..34968084 TCCACCTCTCGTCGGTATTC Chr5:34968064..34968083 60.07 55
downstream ENSMUSE00000654119 Chr5:34971064..34971162 AGCTGACTGGTCTGGAGGAC Chr5:34971122..34971141 59.43 60
downstream ENSMUSE00000348510 Chr5:34971785..34971821 No primer for this exon
downstream ENSMUSE00000698960 Chr5:34971788..34971821 No primer for this exon
downstream ENSMUSE00000380985 Chr5:34973119..34974954 ACCTCCCCACACAAGTCAAG Chr5:34974341..34974360 60 55
downstream ENSMUSE00000698957 Chr5:34973119..34973465 GACGGGGTACGGAACTTCTT Chr5:34973431..34973450 60.36 55
downstream ENSMUSE00000698959 Chr5:34973119..34974943 ACCTCCCCACACAAGTCAAG Chr5:34974341..34974360 60 55
downstream ENSMUSE00000698968 Chr5:34973119..34974264 ATGGGAGGGGGCTCTAGTTA Chr5:34973602..34973621 59.92 55
downstream ENSMUSE00000698973 Chr5:34973119..34974264 ATGGGAGGGGGCTCTAGTTA Chr5:34973602..34973621 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTAATCGCCTTGCAGCAC Chr5:34917322..34917342 61.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAAACGTGACTGGGAAAAC Chr5:34917320..34917340 58.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029106