Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29696
Trapped Gene
Tsc22d1 (ENSMUSG00000022010)
Vector Insertion
Chr 14: 76818817 - 76888242
Public Clones E114F03 (ggtc) E114F02 (ggtc) D109G01 (ggtc) IST12439B6 (tigm) IST14425F2 (tigm)
IST10879F4 (tigm) IST15103E8 (tigm) IST14285H8 (tigm) IST10177E7 (tigm)
IST11125C5 (tigm) IST12358E1 (tigm) IST14965D1 (tigm) IST11619D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000403113 (Chr14:76815628..76818816 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000403113 (Chr14:76815628..76818816 +)
Downstram Exon
ENSMUSE00000685772 (Chr14:76888243..76888482 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55 ACAGATGCTCGAACCTGACC Chr14:76888315..76888334 60.27 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685776 Chr14:76814768..76815524 No primer for this exon
upstream ENSMUSE00000555055 Chr14:76815499..76815524 No primer for this exon
upstream ENSMUSE00000403113 Chr14:76815628..76818816 CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55
upstream ENSMUSE00000555054 Chr14:76815724..76816796 ACTAGCGTTACTCCGGCTCA Chr14:76816229..76816248 60.04 55
upstream ENSMUSE00000685775 Chr14:76815724..76816796 ACTAGCGTTACTCCGGCTCA Chr14:76816229..76816248 60.04 55
upstream ENSMUSE00000706438 Chr14:76815953..76818816 CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55
upstream ENSMUSE00000555053 Chr14:76817043..76818816 CTGTGGGAGTGGTTTCCAGT Chr14:76817055..76817074 60 55

*** Putative Vector Insertion (Chr 14: 76818817 - 76888242) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000685772 Chr14:76888243..76888482 ACAGATGCTCGAACCTGACC Chr14:76888315..76888334 60.27 55
downstream ENSMUSE00000685770 Chr14:76903636..76903653 No primer for this exon
downstream ENSMUSE00000122901 Chr14:76904321..76904648 ATCCATCGCCACTGGTCTAC Chr14:76904562..76904581 59.96 55
downstream ENSMUSE00000122900 Chr14:76905056..76905104 GCTACCACACTTGCACCAGA Chr14:76905079..76905098 59.9 55
downstream ENSMUSE00000647340 Chr14:76905056..76905104 GCTACCACACTTGCACCAGA Chr14:76905079..76905098 59.9 55
downstream ENSMUSE00000685769 Chr14:76906224..76907569 TCGCAAGACTTCAGCAGCTA Chr14:76907377..76907396 60.03 50
downstream ENSMUSE00000685771 Chr14:76906224..76906977 TACTGGGGAGAAAGCGAGAA Chr14:76906643..76906662 59.95 50
downstream ENSMUSE00000685774 Chr14:76906224..76907569 TCGCAAGACTTCAGCAGCTA Chr14:76907377..76907396 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTGCTACCGCTGACAAC Chr14:76863771..76863791 60.32 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTGCTACCGCTGACAAC Chr14:76863771..76863791 60.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022010