Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29712
Trapped Gene
Gramd1b (ENSMUSG00000040111)
Vector Insertion
Chr 9: 40199264 - 40220960
Public Clones (sanger) D078C11 (ggtc) D156C11 (ggtc) D078C11 (ggtc) D156C11 (ggtc)
E100B06 (ggtc) IST10916E2 (tigm) IST12342D8 (tigm) IST13097F2 (tigm)
IST12592H3 (tigm) IST10916F2 (tigm) IST10571D10 (tigm) IST14987B3 (tigm)
IST12156E2 (tigm) IST13098D2 (tigm) IST10662A2 (tigm) IST14921E3 (tigm)
IST10818C12 (tigm) IST10589C1 (tigm) IST13811E9 (tigm) IST11719E7 (tigm)
IST14374C9 (tigm) IST12090E1 (tigm) IST10571C6 (tigm) IST13355C5 (tigm)
IST14247C5 (tigm) IST13811A9 (tigm) IST14112F5 (tigm) IST12522G5 (tigm)
IST10441C4 (tigm) IST14771B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000393136 (Chr9:40220882..40220959 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGATGATTCGAGCAGGTTC Chr9:40220908..40220927 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000393136 (Chr9:40220882..40220959 -)
Downstram Exon
ENSMUSE00000714797 (Chr9:40199265..40199737 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGATGATTCGAGCAGGTTC Chr9:40220908..40220927 60.23 50 TCACAAATGTCCACCCAGAA Chr9:40199325..40199344 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712342 Chr9:40338605..40338968 AGGTATCTCCGACTGGATCG Chr9:40338801..40338820 59.12 55
upstream ENSMUSE00000347263 Chr9:40262879..40263349 AACTGCCGTCCATTGAGATT Chr9:40263007..40263026 59.56 45
upstream ENSMUSE00000393136 Chr9:40220882..40220959 ACGATGATTCGAGCAGGTTC Chr9:40220908..40220927 60.23 50
upstream ENSMUSE00000714797 Chr9:40199265..40199737 TTCTGGGTGGACATTTGTGA Chr9:40199347..40199366 59.94 45

*** Putative Vector Insertion (Chr 9: 40199264 - 40220960) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000709787 Chr9:40153493..40153875 AGCGGAACAGAAGTCCCTTT Chr9:40153767..40153786 60.25 50
downstream ENSMUSE00000334158 Chr9:40141030..40141240 GTCCGAGGAGTGATCTGAGC Chr9:40141089..40141108 59.95 60
downstream ENSMUSE00000715720 Chr9:40141030..40141240 GTCCGAGGAGTGATCTGAGC Chr9:40141089..40141108 59.95 60
downstream ENSMUSE00000720187 Chr9:40141021..40141240 GTCCGAGGAGTGATCTGAGC Chr9:40141089..40141108 59.95 60
downstream ENSMUSE00000507398 Chr9:40135003..40135023 No primer for this exon
downstream ENSMUSE00000152013 Chr9:40125094..40125178 TCCGTGTCTGGAAGTTGCTT Chr9:40125086..40125105 60.83 50
downstream ENSMUSE00000347140 Chr9:40124450..40124553 AGGTAGAGTCGGCCCTGAAG Chr9:40124480..40124499 60.78 60
downstream ENSMUSE00000272680 Chr9:40123273..40123368 TGAGGCGAGCTGTTTTCTCT Chr9:40123289..40123308 60.28 50
downstream ENSMUSE00000272648 Chr9:40122552..40122632 TTTTCAAGGAGAGCATTCTGC Chr9:40122531..40122551 59.58 42.86
downstream ENSMUSE00000272626 Chr9:40119343..40119458 GGAGGCACGTAGTCCTCATC Chr9:40119345..40119364 59.69 60
downstream ENSMUSE00000272606 Chr9:40117483..40117639 TTCCCGTAGACGTCAGTGTG Chr9:40117481..40117500 59.74 55
downstream ENSMUSE00000333550 Chr9:40115878..40116067 GTTGTCAATGGCAAGCTCCT Chr9:40115971..40115990 60.26 50
downstream ENSMUSE00000418157 Chr9:40115441..40115584 TGTCCACGCTGAAGTTGAAG Chr9:40115488..40115507 60.03 50
downstream ENSMUSE00000364853 Chr9:40114325..40114443 TCACTCGACTCTGGTTTCCA Chr9:40114368..40114387 59.39 50
downstream ENSMUSE00000272812 Chr9:40113917..40114059 ACATCGTGGGTGAGGACTTC Chr9:40113970..40113989 59.97 55
downstream ENSMUSE00000272796 Chr9:40112651..40112754 GATAGCGGAGCTCTGTGGAG Chr9:40112710..40112729 60.12 60
downstream ENSMUSE00000272772 Chr9:40111908..40112111 CTTCATCAGTGGGTGTGGTG Chr9:40111916..40111935 60 55
downstream ENSMUSE00000272748 Chr9:40111083..40111173 ACAGCTGATAACCAGCAGCA Chr9:40111063..40111082 59.62 50
downstream ENSMUSE00000716799 Chr9:40108025..40108036 No primer for this exon
downstream ENSMUSE00000403392 Chr9:40107574..40107681 TGAGGGTCTGGGTGGTGTAT Chr9:40107583..40107602 60.24 55
downstream ENSMUSE00000367388 Chr9:40107187..40107304 AGCTCGGTGTCGTGGTACTT Chr9:40107214..40107233 59.79 55
downstream ENSMUSE00000717944 Chr9:40105531..40105664 TTCCTCTTCTCGTCGCTCTC Chr9:40105566..40105585 59.83 55
downstream ENSMUSE00000339314 Chr9:40105492..40105664 TTCCTCTTCTCGTCGCTCTC Chr9:40105566..40105585 59.83 55
downstream ENSMUSE00000711659 Chr9:40105461..40105664 TTCCTCTTCTCGTCGCTCTC Chr9:40105566..40105585 59.83 55
downstream ENSMUSE00000715641 Chr9:40100824..40102012 ACATGCTGGGGTAGATCGTC Chr9:40101441..40101460 59.96 55
downstream ENSMUSE00000720137 Chr9:40100818..40105664 GGCGACTATGCTCACTCCTC Chr9:40104454..40104473 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTTCAGGCTCCAAGACC Chr9:40211976..40211996 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGCATCTTCAGGCTCCAA Chr9:40220980..40221000 60.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040111