Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29714
Trapped Gene
T2 (ENSMUSG00000058159)
Vector Insertion
Chr 17: 8589740 - 8604682
Public Clones E098A02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000658333 (Chr17:8589626..8589739 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGGAGAAGGAGAGGATAA Chr17:8589664..8589683 60.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000658333 (Chr17:8589626..8589739 +)
Downstram Exon
ENSMUSE00000658332 (Chr17:8604683..8604766 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGGAGAAGGAGAGGATAA Chr17:8589664..8589683 60.53 55 TTTTTCTCCATTCCGTGAGC Chr17:8604719..8604738 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658334 Chr17:8589494..8589508 No primer for this exon
upstream ENSMUSE00000658333 Chr17:8589626..8589739 CCCGGAGAAGGAGAGGATAA Chr17:8589664..8589683 60.53 55

*** Putative Vector Insertion (Chr 17: 8589740 - 8604682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658332 Chr17:8604683..8604766 TTTTTCTCCATTCCGTGAGC Chr17:8604719..8604738 60.19 45
downstream ENSMUSE00000658331 Chr17:8605916..8606022 ACATCCGATACAACCGGCTA Chr17:8605988..8606007 60.35 50
downstream ENSMUSE00000512649 Chr17:8610046..8610106 CAGCATCCATGTCTGCAAAG Chr17:8610089..8610108 60.41 50
downstream ENSMUSE00000508072 Chr17:8610859..8611085 GGGACGTCTCTGTGGACTTT Chr17:8611047..8611066 59.15 55
downstream ENSMUSE00000658330 Chr17:8614473..8614587 CTCTCGTGTTCGGAGAGCTT Chr17:8614499..8614518 59.74 55
downstream ENSMUSE00000658329 Chr17:8614970..8615124 No primer for this exon
downstream ENSMUSE00000658328 Chr17:8615392..8615589 CTGCCTGACTGTCTCCATCA Chr17:8615452..8615471 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA Chr17:8595789..8595809 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCACAGGGCATTTAAGAAG Chr17:8595712..8595732 59.56 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058159