Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29721
Trapped Gene
Epas1 (ENSMUSG00000024140)
Vector Insertion
Chr 17: 87153649 - 87195014
Public Clones E092C02 (ggtc) (ggtc) IST14673F12 (tigm) IST14259D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000400252 (Chr17:87153482..87153648 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGCGAGCACTAAAGACCT Chr17:87153488..87153507 59.64 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000400252 (Chr17:87153482..87153648 +)
Downstram Exon
ENSMUSE00000691023 (Chr17:87195015..87195036 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGCGAGCACTAAAGACCT Chr17:87153488..87153507 59.64 55 TTTCTGCCTGTCTTTGAGCA Chr17:87195038..87195057 59.72 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400252 Chr17:87153482..87153648 CCTGCGAGCACTAAAGACCT Chr17:87153488..87153507 59.64 55

*** Putative Vector Insertion (Chr 17: 87153649 - 87195014) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000691023 Chr17:87195015..87195036 TTTCTGCCTGTCTTTGAGCA Chr17:87195038..87195057 59.72 45
downstream ENSMUSE00000691022 Chr17:87196452..87196646 GGAGCTTATGTGTCCGAAGG Chr17:87196640..87196659 59.69 55
downstream ENSMUSE00000242509 Chr17:87196456..87196646 GGAGCTTATGTGTCCGAAGG Chr17:87196640..87196659 59.69 55
downstream ENSMUSE00000138650 Chr17:87204533..87204684 TTGCTGATGTTTTCCGACAG Chr17:87204668..87204687 59.84 45
downstream ENSMUSE00000138638 Chr17:87205097..87205181 GATCTCCTCATGGTCGCAAG Chr17:87205159..87205178 60.77 55
downstream ENSMUSE00000138654 Chr17:87208698..87208816 GGTGGACACGTCTTTGCTCT Chr17:87208738..87208757 60.31 55
downstream ENSMUSE00000138643 Chr17:87208924..87209129 ACTTCATGTCCATGCTGTGG Chr17:87209113..87209132 59.55 50
downstream ENSMUSE00000242439 Chr17:87217695..87217801 CATAGGCAGAGCGTCCAAGT Chr17:87217753..87217772 60.42 55
downstream ENSMUSE00000242428 Chr17:87223020..87223167 CTCCGTGTTTGGCTAGCATC Chr17:87223079..87223098 60.8 55
downstream ENSMUSE00000138641 Chr17:87223747..87223961 ACCACGTCGTTCTTCTCGAT Chr17:87223773..87223792 59.73 50
downstream ENSMUSE00000138648 Chr17:87224920..87225110 CCATAGGCTGAGGGTTCATC Chr17:87224956..87224975 59.51 55
downstream ENSMUSE00000242381 Chr17:87225845..87225955 TGGCGAAAAGCTTCTCAATC Chr17:87225923..87225942 60.47 45
downstream ENSMUSE00000242354 Chr17:87226832..87227337 TAGGGATGTAGGGTGCCAAG Chr17:87226883..87226902 59.95 55
downstream ENSMUSE00000242323 Chr17:87228030..87228156 CCGCTTTAGCTTCAGCTTGT Chr17:87228117..87228136 59.79 50
downstream ENSMUSE00000138646 Chr17:87228326..87228440 TTCGCACTGATGGTCTTGTC Chr17:87228432..87228451 59.84 50
downstream ENSMUSE00000242272 Chr17:87228650..87228823 AGCTCCTGGAGGACCGTAGT Chr17:87228813..87228832 60.27 60
downstream ENSMUSE00000481232 Chr17:87230291..87230921 TGAGTTGAATGACGCCAAAG Chr17:87230841..87230860 59.84 45
downstream ENSMUSE00000691024 Chr17:87230291..87230659 CAGTTCCGGCAACAGGTAAG Chr17:87230349..87230368 60.68 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTACCCCCTTTTGTCCCTA Chr17:87177607..87177627 60.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTACCCCCTTTTGTCCCTA Chr17:87177607..87177627 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024140