Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29722
Trapped Gene
Bpnt1 (ENSMUSG00000026617)
Vector Insertion
Chr 1: 187156143 - 187161984
Public Clones (sanger) (sanger) (ggtc) (ggtc) E091H04 (ggtc) (ggtc)
IST14729F7 (tigm) IST14126H11 (tigm) IST14012D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000686071 (Chr1:187156059..187156142 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGGACCAGTGGACTTGGA Chr1:187156059..187156078 60.36 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000686071 (Chr1:187156059..187156142 +)
Downstram Exon
ENSMUSE00000161066 (Chr1:187161985..187162111 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGGACCAGTGGACTTGGA Chr1:187156059..187156078 60.36 50 TCCTGCCTTTTGAGCGATAG Chr1:187162063..187162082 60.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403926 Chr1:187156028..187156142 ATTGGACCAGTGGACTTGGA Chr1:187156059..187156078 60.36 50
upstream ENSMUSE00000686071 Chr1:187156059..187156142 ATTGGACCAGTGGACTTGGA Chr1:187156059..187156078 60.36 50

*** Putative Vector Insertion (Chr 1: 187156143 - 187161984) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000161066 Chr1:187161985..187162111 TCCTGCCTTTTGAGCGATAG Chr1:187162063..187162082 60.48 50
downstream ENSMUSE00000706554 Chr1:187161992..187162111 TCCTGCCTTTTGAGCGATAG Chr1:187162063..187162082 60.48 50
downstream ENSMUSE00000161070 Chr1:187165102..187165206 TATGCTCATCTGCACCAAGC Chr1:187165158..187165177 59.98 50
downstream ENSMUSE00000161064 Chr1:187169194..187169301 CCCGTCTTCAATCAGCTCTT Chr1:187169241..187169260 59.43 50
downstream ENSMUSE00000161060 Chr1:187170554..187170602 CTAAGGGGTCAACCCAAACC Chr1:187170581..187170600 60.58 55
downstream ENSMUSE00000161058 Chr1:187172623..187172714 AATACGGCTGGTTGATGATG Chr1:187172706..187172725 58.45 45
downstream ENSMUSE00000161056 Chr1:187176061..187176258 TGGTTGCTATGGGATCTGGT Chr1:187176191..187176210 60.34 50
downstream ENSMUSE00000161054 Chr1:187177836..187177941 AGAAGCTTTGCCTTCGATCA Chr1:187177868..187177887 60.1 45
downstream ENSMUSE00000344053 Chr1:187180357..187181656 TTCCCATGGATGTCTGTCAA Chr1:187180384..187180403 59.89 45
downstream ENSMUSE00000686057 Chr1:187180357..187180660 TCTGGAACATGGCTTGCATA Chr1:187180480..187180499 60.22 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:187159193..187159213 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGCTAGCTATTGGTCACAA Chr1:187159160..187159180 58.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026617