Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29742
Trapped Gene
Camk1d (ENSMUSG00000039145)
Vector Insertion
Chr 2: 5596959 - 5635284
Public Clones E088A02 (ggtc) IST10218D11 (tigm) IST13149E1 (tigm) IST10668H3 (tigm)
IST14434E2 (tigm) IST12893H8 (tigm) IST10879B10 (tigm) IST13149F3 (tigm)
IST11343C2 (tigm) IST14998H11 (tigm) IST11360E10 (tigm) IST11001B3 (tigm)
IST10860F1 (tigm) IST12628B6 (tigm) IST14312C10 (tigm) IST13360G2 (tigm)
IST14312C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000647805 (Chr2:5635192..5635283 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCTGGAAAAAGCAAGCAG Chr2:5635235..5635254 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000647805 (Chr2:5635192..5635283 -)
Downstram Exon
ENSMUSE00000701339 (Chr2:5596960..5597027 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCTGGAAAAAGCAAGCAG Chr2:5635235..5635254 60.12 50 TGGAACCCTTTATCCAGCTC Chr2:5596945..5596964 59.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000570238 Chr2:5635192..5635808 CAAGGCGAAAGAGGAAACTG Chr2:5635437..5635456 59.99 50
upstream ENSMUSE00000647805 Chr2:5635192..5635283 CTCCTGGAAAAAGCAAGCAG Chr2:5635235..5635254 60.12 50
upstream ENSMUSE00000701339 Chr2:5596960..5597027 GGAGCTGGATAAAGGGTTCC Chr2:5596968..5596987 59.9 55

*** Putative Vector Insertion (Chr 2: 5596959 - 5635284) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000402447 Chr2:5486695..5486826 ATCTCGTTCTCGATGCTGCT Chr2:5486688..5486707 60.13 50
downstream ENSMUSE00000570237 Chr2:5366116..5366190 TGCATGACCAGGTAGAGGTG Chr2:5366097..5366116 59.7 55
downstream ENSMUSE00000701332 Chr2:5283801..5283824 No primer for this exon
downstream ENSMUSE00000313360 Chr2:5283035..5283173 CCGATCGAAGAGTTCTCCAC Chr2:5283124..5283143 59.8 55
downstream ENSMUSE00000701331 Chr2:5283035..5283175 CCGATCGAAGAGTTCTCCAC Chr2:5283124..5283143 59.8 55
downstream ENSMUSE00000313356 Chr2:5275715..5275841 TCGACAAGCCAAAGTCACTG Chr2:5275750..5275769 60.03 50
downstream ENSMUSE00000430583 Chr2:5260228..5260303 GTTTCTGGGCGAGAACTTCC Chr2:5260258..5260277 61.13 55
downstream ENSMUSE00000570233 Chr2:5234135..5234247 CCCAGTAGGGGGAATCAAAC Chr2:5234131..5234150 60.55 55
downstream ENSMUSE00000570230 Chr2:5232038..5232116 TCCATCAGATTCCGAATGAAG Chr2:5232067..5232087 60.02 42.86
downstream ENSMUSE00000313338 Chr2:5224337..5224424 TGCAAAATTCTTCCGGATCT Chr2:5224330..5224349 59.65 40
downstream ENSMUSE00000647804 Chr2:5222585..5222659 AGCCTCCGCATATGTCTCAC Chr2:5222594..5222613 60.25 55
downstream ENSMUSE00000398917 Chr2:5222542..5222659 AGCCTCCGCATATGTCTCAC Chr2:5222594..5222613 60.25 55
downstream ENSMUSE00000647803 Chr2:5220055..5220147 TCTCCTCTCAGCTCCGACTC Chr2:5220052..5220071 59.82 60
downstream ENSMUSE00000701337 Chr2:5219686..5220147 GCTCCCCTTGAGTCAGTCAG Chr2:5219801..5219820 59.99 60
downstream ENSMUSE00000707233 Chr2:5219686..5220147 GCTCCCCTTGAGTCAGTCAG Chr2:5219801..5219820 59.99 60
downstream ENSMUSE00000430604 Chr2:5214510..5220147 GTCCACTCACGGTTGGTCTT Chr2:5217468..5217487 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTCCTGGAAAAAGCAAG Chr2:5632236..5632256 59.05 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAAATTGGTGCGCATGTCAG Chr2:5632240..5632261 60.9 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039145