Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29749
Trapped Gene
Wnt3 (ENSMUSG00000000125)
Vector Insertion
Chr 11: 103635663 - 103669463
Public Clones E085C03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000227313 (Chr11:103635489..103635662 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000227313 (Chr11:103635489..103635662 +)
Downstram Exon
ENSMUSE00000227305 (Chr11:103669464..103669705 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000227313 Chr11:103635489..103635662 No primer for this exon

*** Putative Vector Insertion (Chr 11: 103635663 - 103669463) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000227305 Chr11:103669464..103669705 No primer for this exon
downstream ENSMUSE00000107907 Chr11:103672642..103672907 No primer for this exon
downstream ENSMUSE00000227288 Chr11:103673595..103674082 No primer for this exon
downstream ENSMUSE00000346339 Chr11:103677391..103679274 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCCTTTTAATCGCCTTG Chr11:103641705..103641725 58.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTGTCCCACCAACCTTTG Chr11:103641681..103641701 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000125