Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29750
Trapped Gene
Lgtn (ENSMUSG00000026427)
Vector Insertion
Chr 1: 133057980 - 133060096
Public Clones E084E09 (ggtc) E084D09 (ggtc) E084G10 (ggtc) E084B10 (ggtc) E084E07 (ggtc)
E084C10 (ggtc) E084G09 (ggtc) E084A07 (ggtc) E084D10 (ggtc) E084H12 (ggtc)
E084C09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158978 (Chr1:133057862..133057979 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTTACTGCGGTGCTTCCT Chr1:133057876..133057895 60.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158978 (Chr1:133057862..133057979 +)
Downstram Exon
ENSMUSE00000158974 (Chr1:133060097..133060142 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTTACTGCGGTGCTTCCT Chr1:133057876..133057895 60.45 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000492514 Chr1:133049773..133050002 GCCACTCCTTCGTTTTGTTG Chr1:133049874..133049893 60.67 50
upstream ENSMUSE00000502768 Chr1:133049825..133050002 CTGGCGTCTGTGCTCTTCTT Chr1:133049901..133049920 60.73 55
upstream ENSMUSE00000158959 Chr1:133050806..133050996 ATGTTCACAAAGGGGATTCG Chr1:133050910..133050929 59.79 45
upstream ENSMUSE00000158958 Chr1:133051745..133051828 TGGCCTCTGGTATTGGAAAA Chr1:133051792..133051811 60.44 45
upstream ENSMUSE00000250310 Chr1:133052210..133052300 AAGTACAGCAAGGCGACCTC Chr1:133052255..133052274 59.5 55
upstream ENSMUSE00000250304 Chr1:133054769..133054876 CATGTCCACAGCTCAGATGC Chr1:133054796..133054815 60.44 55
upstream ENSMUSE00000480771 Chr1:133056987..133057201 CCACTGGACCCCACAGATAG Chr1:133057024..133057043 60.38 60
upstream ENSMUSE00000158978 Chr1:133057862..133057979 CTGTTACTGCGGTGCTTCCT Chr1:133057876..133057895 60.45 55

*** Putative Vector Insertion (Chr 1: 133057980 - 133060096) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158974 Chr1:133060097..133060142 No primer for this exon
downstream ENSMUSE00000158975 Chr1:133060980..133061083 CCTTTGCTCAGCTCCTTGAC Chr1:133061047..133061066 60.13 55
downstream ENSMUSE00000158982 Chr1:133061197..133061346 GGGATGACGAAAGACGTGAT Chr1:133061220..133061239 59.93 50
downstream ENSMUSE00000158971 Chr1:133061697..133061786 CGTGATGATCTTTCGGACCT Chr1:133061745..133061764 60.07 50
downstream ENSMUSE00000158984 Chr1:133062904..133062999 GAGCTTCGTGACCAAGTGCT Chr1:133062979..133062998 60.6 55
downstream ENSMUSE00000158973 Chr1:133064697..133064817 GGTCTTCAGTGCAAGGGTGA Chr1:133064808..133064827 61.26 55
downstream ENSMUSE00000516727 Chr1:133067514..133067688 AAGTTCCGGACCACAGTCAC Chr1:133067536..133067555 60.01 55
downstream ENSMUSE00000691714 Chr1:133068498..133068811 TTTCGCTGGACCTCAGTTTT Chr1:133068626..133068645 59.85 45
downstream ENSMUSE00000447257 Chr1:133069881..133070048 ATGGGGTCCACTGCATAAAA Chr1:133069979..133069998 60.19 45
downstream ENSMUSE00000447223 Chr1:133075177..133075218 GAGGAGCAGGACAAGATCCA Chr1:133075203..133075222 60.35 55
downstream ENSMUSE00000691722 Chr1:133079345..133079463 TGGGGGTATTGAGCTGGTAA Chr1:133079390..133079409 60.32 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTCTCCTTGGCAGTCACA Chr1:133057948..133057968 60.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTCTCCTTGGCAGTCACA Chr1:133057948..133057968 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026427