Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29752
Trapped Gene
Sparc (ENSMUSG00000018593)
Vector Insertion
Chr 11: 55223429 - 55233352
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) E042E10 (ggtc) D069H07 (ggtc) D069D10 (ggtc) (ggtc)
D151F03 (ggtc) D069G07 (ggtc) E084G11 (ggtc) D069D10 (ggtc) D151F03 (ggtc)
D069G07 (ggtc) IST14515A6 (tigm) IST10879F8 (tigm) IST14309B9 (tigm)
IST14947B4 (tigm) IST14133E4 (tigm) IST14751A9 (tigm) IST14988G2 (tigm)
IST14419H6 (tigm) IST14488D4 (tigm) IST14996C5 (tigm) IST14587F7 (tigm)
IST10877A2 (tigm) IST14639C2 (tigm) IST14718G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000448061 (Chr11:55233290..55233351 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000448061 (Chr11:55233290..55233351 -)
Downstram Exon
ENSMUSE00000708374 (Chr11:55223430..55223499 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448061 Chr11:55233290..55233351 No primer for this exon
upstream ENSMUSE00000678286 Chr11:55233290..55233400 No primer for this exon
upstream ENSMUSE00000448048 Chr11:55223430..55223499 No primer for this exon
upstream ENSMUSE00000708374 Chr11:55223430..55223499 No primer for this exon

*** Putative Vector Insertion (Chr 11: 55223429 - 55233352) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000448030 Chr11:55220722..55220781 No primer for this exon
downstream ENSMUSE00000678285 Chr11:55220722..55220778 No primer for this exon
downstream ENSMUSE00000448024 Chr11:55220012..55220099 No primer for this exon
downstream ENSMUSE00000448017 Chr11:55218682..55218803 No primer for this exon
downstream ENSMUSE00000307396 Chr11:55215453..55215573 No primer for this exon
downstream ENSMUSE00000307389 Chr11:55212694..55212827 No primer for this exon
downstream ENSMUSE00000102602 Chr11:55212050..55212198 No primer for this exon
downstream ENSMUSE00000102587 Chr11:55209303..55209451 No primer for this exon
downstream ENSMUSE00000678288 Chr11:55208939..55209115 No primer for this exon
downstream ENSMUSE00000448041 Chr11:55208002..55209115 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTCTAAACCCCTCCACAT Chr11:55224364..55224384 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTCTAAACCCCTCCACAT Chr11:55224364..55224384 60.33 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018593