Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29754
Trapped Gene
Cep152 (ENSMUSG00000068394)
Vector Insertion
Chr 2: 125402449 - 125405761
Public Clones E082E08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000560000 (Chr2:125405110..125405760 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATGAGGAAGTCCCAGTGA Chr2:125405613..125405632 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000560000 (Chr2:125405110..125405760 -)
Downstram Exon
ENSMUSE00000559998 (Chr2:125402450..125402591 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATGAGGAAGTCCCAGTGA Chr2:125405613..125405632 60.05 55 CTGAGCACAGCGTACAGAGG Chr2:125402462..125402481 59.79 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510503 Chr2:125450612..125450849 GCGTTCGAGTCTCCTACACC Chr2:125450713..125450732 59.87 60
upstream ENSMUSE00000511447 Chr2:125446909..125447002 GTCATTGGAGTTTGGCAGTG Chr2:125446974..125446993 59.14 50
upstream ENSMUSE00000500963 Chr2:125446023..125446126 ACAGACCTCCCTCACGACAT Chr2:125446092..125446111 59.56 55
upstream ENSMUSE00000501730 Chr2:125445733..125445805 GAAGTGGATTGAGCGGGATA Chr2:125445759..125445778 60.04 50
upstream ENSMUSE00000498953 Chr2:125445402..125445626 AGCCAGCGTGATTACGTTTT Chr2:125445428..125445447 59.78 45
upstream ENSMUSE00000499789 Chr2:125444109..125444277 GGCTTGCAGCAACAGTTTTT Chr2:125444123..125444142 60.43 45
upstream ENSMUSE00000504369 Chr2:125440024..125440167 CAACTGGACAGCTTGGTTGA Chr2:125440086..125440105 59.87 50
upstream ENSMUSE00000505351 Chr2:125438673..125438812 TGAAGCTCAGATTGCAGCAC Chr2:125438714..125438733 60.3 50
upstream ENSMUSE00000503305 Chr2:125436744..125436944 AGCCTGAAACAGCAACTGGT Chr2:125436886..125436905 59.91 50
upstream ENSMUSE00000504278 Chr2:125431072..125431219 AAGGACCACGTGCAACAACT Chr2:125431179..125431198 60.61 50
upstream ENSMUSE00000493500 Chr2:125428578..125428669 AGAAGGCCCACGTCCTAAGT Chr2:125428602..125428621 60.13 55
upstream ENSMUSE00000494536 Chr2:125426885..125427048 AGGTGACTCCGAAGGAGACC Chr2:125426961..125426980 60.65 60
upstream ENSMUSE00000491381 Chr2:125420609..125420807 AACTCCGTGAAGCGACATCT Chr2:125420697..125420716 59.87 50
upstream ENSMUSE00000560013 Chr2:125415846..125415968 No primer for this exon
upstream ENSMUSE00000560012 Chr2:125415192..125415301 GACCACGATAAGCAGGAAGC Chr2:125415201..125415220 59.84 55
upstream ENSMUSE00000560011 Chr2:125413629..125413757 GGTCTATGAGGGGACCCAGT Chr2:125413639..125413658 60.19 60
upstream ENSMUSE00000560010 Chr2:125413337..125413463 TGCTGTGCAGGAGTGTTACC Chr2:125413411..125413430 59.9 55
upstream ENSMUSE00000560006 Chr2:125412067..125412210 CTGAAGACGGAAAGGCAGAG Chr2:125412116..125412135 60.13 55
upstream ENSMUSE00000560003 Chr2:125409528..125409800 AGGAAGCCCGAAGTTGAGTT Chr2:125409562..125409581 60.25 50
upstream ENSMUSE00000560001 Chr2:125407432..125407563 GTGGAAACAGCTGTGCAGAA Chr2:125407544..125407563 60.03 50
upstream ENSMUSE00000560000 Chr2:125405110..125405760 GGATGAGGAAGTCCCAGTGA Chr2:125405613..125405632 60.05 55
upstream ENSMUSE00000559998 Chr2:125402450..125402591 CACCTCTGTACGCTGTGCTC Chr2:125402486..125402505 59.65 60

*** Putative Vector Insertion (Chr 2: 125402449 - 125405761) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000559996 Chr2:125397405..125397569 AAGCAGTGTCCACAGCGTAA Chr2:125397502..125397521 59.51 50
downstream ENSMUSE00000559993 Chr2:125395291..125395387 ATTCTTCAACCACCCTGCTG Chr2:125395339..125395358 60.11 50
downstream ENSMUSE00000559990 Chr2:125394560..125394663 No primer for this exon
downstream ENSMUSE00000559989 Chr2:125392269..125392425 CATCTTCCGTGCAGTTTCCT Chr2:125392306..125392325 60.26 50
downstream ENSMUSE00000559988 Chr2:125391945..125392057 No primer for this exon
downstream ENSMUSE00000559987 Chr2:125388824..125390133 AGATGGGTGTCCCAGAGTTG Chr2:125389258..125389277 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCAAATGTGTGCTGCTGTG Chr2:125405767..125405787 59.46 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTTAACAGGCAGCGTGAC Chr2:125405704..125405724 59.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068394