Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29762
Trapped Gene
Mrpl24 (ENSMUSG00000019710)
Vector Insertion
Chr 3: 87723751 - 87725738
Public Clones E080A06 (ggtc) E080A06 (ggtc) IST11644G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720096 (Chr3:87723428..87723750 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720096 (Chr3:87723428..87723750 +)
Downstram Exon
ENSMUSE00000712426 (Chr3:87725739..87725970 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720096 Chr3:87723428..87723750 No primer for this exon
upstream ENSMUSE00000175795 Chr3:87723466..87723627 No primer for this exon
upstream ENSMUSE00000708200 Chr3:87723485..87723573 No primer for this exon

*** Putative Vector Insertion (Chr 3: 87723751 - 87725738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000719407 Chr3:87725531..87725970 No primer for this exon
downstream ENSMUSE00000175792 Chr3:87725739..87725970 No primer for this exon
downstream ENSMUSE00000712426 Chr3:87725739..87725970 No primer for this exon
downstream ENSMUSE00000175794 Chr3:87726053..87726148 No primer for this exon
downstream ENSMUSE00000175793 Chr3:87726310..87726413 No primer for this exon
downstream ENSMUSE00000175797 Chr3:87726857..87726987 No primer for this exon
downstream ENSMUSE00000175796 Chr3:87727132..87727355 No primer for this exon
downstream ENSMUSE00000717961 Chr3:87727132..87727584 No primer for this exon
downstream ENSMUSE00000721275 Chr3:87727132..87727594 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGGCTCCTCTTTTGCTA Chr3:87723705..87723725 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTACTTGAGGCGGTGACCT Chr3:87723768..87723789 60.01 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019710