Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29765
Trapped Gene
Hhla1 (ENSMUSG00000072511)
Vector Insertion
Chr 15: 65755421 - 65761868
Public Clones E079F05 (ggtc) (ggtc) E046D10 (ggtc) (ggtc) D059G02 (ggtc) E079F05 (ggtc)
(ggtc) D131G08 (ggtc) (ggtc) 3SE386F10 (ggtc) E058F06 (ggtc)
(ggtc) D059G02 (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648867 (Chr15:65761793..65761867 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGCCCATCAAGTTTCAA Chr15:65761793..65761812 60.78 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648867 (Chr15:65761793..65761867 -)
Downstram Exon
ENSMUSE00000648866 (Chr15:65755422..65755578 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGCCCATCAAGTTTCAA Chr15:65761793..65761812 60.78 45 TGAACTGAAATCCCGCTTTT Chr15:65755411..65755430 59.69 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682765 Chr15:65808311..65808366 TTTGAAGTCATTCATCCTGCTC Chr15:65808320..65808341 59.32 40.91
upstream ENSMUSE00000648880 Chr15:65804323..65804420 TGTATGGGCCTTGCCTGTAT Chr15:65804343..65804362 60.35 50
upstream ENSMUSE00000648879 Chr15:65803286..65803345 AAGAAATGGCTCTCCCACCT Chr15:65803293..65803312 60.07 50
upstream ENSMUSE00000648878 Chr15:65798906..65798962 TGAAGGCCTCAAGAAGGAGA Chr15:65798933..65798952 60.06 50
upstream ENSMUSE00000648877 Chr15:65798034..65798090 No primer for this exon
upstream ENSMUSE00000648876 Chr15:65796982..65797062 ACCTGACCGAGCTTGTGAAT Chr15:65797007..65797026 59.73 50
upstream ENSMUSE00000648875 Chr15:65780044..65780127 TTTCCGTGGCCATCTACAAC Chr15:65780045..65780064 60.89 50
upstream ENSMUSE00000648874 Chr15:65779864..65779947 CTACCCGGCACTGCTACTGT Chr15:65779892..65779911 60.33 60
upstream ENSMUSE00000648873 Chr15:65774250..65774333 CTGGTGGACATTGTTGGAAA Chr15:65774300..65774319 59.39 45
upstream ENSMUSE00000648872 Chr15:65773506..65773562 TGTGATGGTGGGAAAGTCAG Chr15:65773506..65773525 59.52 50
upstream ENSMUSE00000648871 Chr15:65773314..65773400 ATGGTGGAGAAATCCCCTGT Chr15:65773355..65773374 60.58 50
upstream ENSMUSE00000648870 Chr15:65767799..65768026 GCAAGGACTTCAAGGCTCAC Chr15:65767990..65768009 60 55
upstream ENSMUSE00000648869 Chr15:65764799..65765035 ACACCATGGGGGACAAATAG Chr15:65765002..65765021 59.53 50
upstream ENSMUSE00000648868 Chr15:65762182..65762250 CCAGCTCCTAGAGTCCCTCA Chr15:65762187..65762206 59.55 60
upstream ENSMUSE00000648867 Chr15:65761793..65761867 AGCAGCCCATCAAGTTTCAA Chr15:65761793..65761812 60.78 45
upstream ENSMUSE00000648866 Chr15:65755422..65755578 AAAAGCGGGATTTCAGTTCA Chr15:65755433..65755452 59.69 40

*** Putative Vector Insertion (Chr 15: 65755421 - 65761868) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648865 Chr15:65754005..65754695 CCAGCCAACTATGACCCAGT Chr15:65754055..65754074 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr15:65758799..65758819 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCATTCTTACGGATGCTGA Chr15:65758863..65758884 60.09 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072511