Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29773
Trapped Gene
Mrps27 (ENSMUSG00000041632)
Vector Insertion
Chr 13: 100114831 - 100118286
Public Clones (sanger) E076H10 (ggtc) D060F04 (ggtc) E076H10 (ggtc) D060D03 (ggtc)
D062H03 (ggtc) D060C03 (ggtc) IST11566H3 (tigm) IST14820C8 (tigm)
IST14945A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294499 (Chr13:100114745..100114830 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294499 (Chr13:100114745..100114830 +)
Downstram Exon
ENSMUSE00000294492 (Chr13:100118287..100118364 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCTCCTTCTCTCTGGCTTCC Chr13:100118355..100118374 60.47 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000294499 Chr13:100114745..100114830 No primer for this exon

*** Putative Vector Insertion (Chr 13: 100114831 - 100118286) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294492 Chr13:100118287..100118364 CCTCCTTCTCTCTGGCTTCC Chr13:100118355..100118374 60.47 60
downstream ENSMUSE00000294486 Chr13:100132920..100132990 No primer for this exon
downstream ENSMUSE00000294479 Chr13:100135180..100135238 ATCTTCTCGGGATGCAATGT Chr13:100135212..100135231 59.51 45
downstream ENSMUSE00000294474 Chr13:100170217..100170331 CAGTTGGGACTGTGTCGAAAT Chr13:100170239..100170259 60.02 47.62
downstream ENSMUSE00000294469 Chr13:100173459..100173537 No primer for this exon
downstream ENSMUSE00000294465 Chr13:100174943..100175058 GTGAGCTCCGTCTTCTCTGC Chr13:100175060..100175079 60.29 60
downstream ENSMUSE00000407388 Chr13:100179764..100179866 AACTCAGGCCCACTGTGTTC Chr13:100179842..100179861 60.16 55
downstream ENSMUSE00000433773 Chr13:100181233..100181375 CATCACTTGGAGGGCTCTGT Chr13:100181330..100181349 60.26 55
downstream ENSMUSE00000294446 Chr13:100182150..100182320 CACCACCTTCAGGACTCCAT Chr13:100182185..100182204 59.96 55
downstream ENSMUSE00000374496 Chr13:100184694..100185517 CTGTCCTGGCTGAACACTGA Chr13:100184972..100184991 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGGCCTCCCAGCACTAAT Chr13:100117866..100117886 58.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAACGTGACTGGGAAAACC Chr13:100117877..100117898 63.93 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041632