Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29780
Trapped Gene
Add1 (ENSMUSG00000029106)
Vector Insertion
Chr 5: 34916563 - 34916690
Public Clones E070C11 (ggtc) E070C11 (ggtc) E070D11 (ggtc) D088C08 (ggtc) IST14614D1 (tigm)
IST14491E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000418981 (Chr5:34916512..34916562 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000418981 (Chr5:34916512..34916562 +)
Downstram Exon
ENSMUSE00000698963 (Chr5:34916691..34917273 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60 GGAGCCACCATTAGCACAAT Chr5:34916897..34916916 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699018 Chr5:34916461..34916562 GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60
upstream ENSMUSE00000418981 Chr5:34916512..34916562 GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60

*** Putative Vector Insertion (Chr 5: 34916563 - 34916690) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000698963 Chr5:34916691..34917273 GGAGCCACCATTAGCACAAT Chr5:34916897..34916916 59.96 50
downstream ENSMUSE00000698962 Chr5:34938218..34938354 TCCTCAGGCTGCTAAGAACC Chr5:34938334..34938353 59.57 55
downstream ENSMUSE00000600629 Chr5:34943973..34944187 CCGAGTGTCACCATTCATTG Chr5:34944013..34944032 59.96 50
downstream ENSMUSE00000708931 Chr5:34943973..34944187 CCGAGTGTCACCATTCATTG Chr5:34944013..34944032 59.96 50
downstream ENSMUSE00000600643 Chr5:34943991..34944187 ATGTTCCTCTCCCGCAAATA Chr5:34944117..34944136 59.53 45
downstream ENSMUSE00000654143 Chr5:34947339..34947501 CTCGCAGTCATGAAATCTGC Chr5:34947448..34947467 59.55 50
downstream ENSMUSE00000654142 Chr5:34948477..34948628 GCGATAGAATCCGACCCTCT Chr5:34948531..34948550 60.57 55
downstream ENSMUSE00000654141 Chr5:34952841..34952921 GAGGAAGTGTTCCTGCTCAGA Chr5:34952875..34952895 59.59 52.38
downstream ENSMUSE00000654139 Chr5:34953139..34953288 CATACACTGCCGAGTGCAGA Chr5:34953235..34953254 61.04 55
downstream ENSMUSE00000654138 Chr5:34955937..34956080 GGGGAGATAGGCAAGAGTCC Chr5:34955977..34955996 60.04 60
downstream ENSMUSE00000654137 Chr5:34956168..34956266 CACGCTCTCTCCAACTGACA Chr5:34956218..34956237 60.18 55
downstream ENSMUSE00000654134 Chr5:34956833..34957009 GAACGGGATTTGGCTTTGTA Chr5:34956915..34956934 59.94 45
downstream ENSMUSE00000654131 Chr5:34959212..34959463 TCTTCGACTTGGGACTGCTT Chr5:34959461..34959480 59.99 50
downstream ENSMUSE00000698966 Chr5:34959212..34959556 TCTTCGACTTGGGACTGCTT Chr5:34959461..34959480 59.99 50
downstream ENSMUSE00000654126 Chr5:34961999..34962100 GGTTAGGGACAGCAGAGGTG Chr5:34962050..34962069 59.72 60
downstream ENSMUSE00000654124 Chr5:34962694..34962783 ACTGAGGTCCTGCCGTCTTA Chr5:34962742..34962761 59.87 55
downstream ENSMUSE00000698961 Chr5:34963481..34963567 GCCCTTCGATAGTTTCCGTA Chr5:34963523..34963542 59.18 50
downstream ENSMUSE00000654122 Chr5:34967928..34968084 TCCACCTCTCGTCGGTATTC Chr5:34968064..34968083 60.07 55
downstream ENSMUSE00000654119 Chr5:34971064..34971162 AGCTGACTGGTCTGGAGGAC Chr5:34971122..34971141 59.43 60
downstream ENSMUSE00000348510 Chr5:34971785..34971821 No primer for this exon
downstream ENSMUSE00000698960 Chr5:34971788..34971821 No primer for this exon
downstream ENSMUSE00000380985 Chr5:34973119..34974954 ACCTCCCCACACAAGTCAAG Chr5:34974341..34974360 60 55
downstream ENSMUSE00000698957 Chr5:34973119..34973465 GACGGGGTACGGAACTTCTT Chr5:34973431..34973450 60.36 55
downstream ENSMUSE00000698959 Chr5:34973119..34974943 ACCTCCCCACACAAGTCAAG Chr5:34974341..34974360 60 55
downstream ENSMUSE00000698968 Chr5:34973119..34974264 ATGGGAGGGGGCTCTAGTTA Chr5:34973602..34973621 59.92 55
downstream ENSMUSE00000698973 Chr5:34973119..34974264 ATGGGAGGGGGCTCTAGTTA Chr5:34973602..34973621 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000029106