Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI298
Trapped Gene
Zswim6 (ENSMUSG00000032846)
Vector Insertion
Chr 13: 108577846 - 108578204
Public Clones GC0487 (tigem) A018D07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000227794 (Chr13:108577847..108578203 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCTTGCCAACTGCACAGAA Chr13:108577897..108577916 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000227794 (Chr13:108577847..108578203 -)
Downstram Exon
ENSMUSE00000679752 (Chr13:108577847..108578211 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCTTGCCAACTGCACAGAA Chr13:108577897..108577916 60.03 50 CTCCGGTTGTATTGCAGGTT Chr13:108578135..108578154 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639831 Chr13:108679591..108679672 CGTAGACAACGTCCTGCAAGT Chr13:108679593..108679613 60.36 52.38
upstream ENSMUSE00000679753 Chr13:108578429..108578445 No primer for this exon
upstream ENSMUSE00000227794 Chr13:108577847..108578203 GTCTTGCCAACTGCACAGAA Chr13:108577897..108577916 60.03 50
upstream ENSMUSE00000679752 Chr13:108577847..108578211 GTCTTGCCAACTGCACAGAA Chr13:108577897..108577916 60.03 50

*** Putative Vector Insertion (Chr 13: 108577846 - 108578204) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568947 Chr13:108563453..108563601 CCAGCAGTTCTCATCGTCAA Chr13:108563530..108563549 59.98 50
downstream ENSMUSE00000341731 Chr13:108559640..108559790 TCAGCCATGAACTGCTCTGT Chr13:108559692..108559711 59.58 50
downstream ENSMUSE00000437486 Chr13:108538264..108538443 TTAGCCAACTGGCTTTTTGC Chr13:108538356..108538375 60.38 45
downstream ENSMUSE00000317618 Chr13:108534041..108534217 TGGCTCTCGTGAACACTGTC Chr13:108534154..108534173 60.03 55
downstream ENSMUSE00000412494 Chr13:108533616..108533762 ACAGGCTGTAGGGACGTGTT Chr13:108533721..108533740 59.65 55
downstream ENSMUSE00000437460 Chr13:108530313..108530459 ACAATCGGAGAAGCCAGAGA Chr13:108530295..108530314 59.95 50
downstream ENSMUSE00000437455 Chr13:108528452..108528712 AACTTGTGTGCAGGCAGATG Chr13:108528636..108528655 59.9 50
downstream ENSMUSE00000394274 Chr13:108523879..108524014 GAACACTCTCCCGATGGATT Chr13:108523945..108523964 58.94 50
downstream ENSMUSE00000568946 Chr13:108521129..108521286 AAAGTGAACCAGCGAGGGTA Chr13:108521166..108521185 59.73 50
downstream ENSMUSE00000317698 Chr13:108520307..108520470 GAGTGATGTCTGGCAAGCTG Chr13:108520317..108520336 59.58 55
downstream ENSMUSE00000317692 Chr13:108518652..108518733 GAGGGTTGACAGGGTCATTC Chr13:108518685..108518704 59.36 55
downstream ENSMUSE00000679747 Chr13:108516962..108517377 AGCAGCATCAAGGACGATTT Chr13:108517078..108517097 59.84 45
downstream ENSMUSE00000437434 Chr13:108516515..108517377 ACTCGCTATAGTGCCGAGGA Chr13:108516639..108516658 60 55
downstream ENSMUSE00000679746 Chr13:108516429..108516455 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAATACAACCGGAGCCTAA Chr13:108578150..108578170 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTGTGCAGAAGCTGACC Chr13:108578223..108578243 60.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032846