Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29804
Trapped Gene
Axin1 (ENSMUSG00000024182)
Vector Insertion
Chr 17: 26275987 - 26279562
Public Clones (sanger) E063D02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000481123 (Chr17:26275679..26275986 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGGGCTGGTGAGAGTGAG Chr17:26275765..26275784 59.58 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000481123 (Chr17:26275679..26275986 +)
Downstram Exon
ENSMUSE00000714239 (Chr17:26279563..26280521 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGGGCTGGTGAGAGTGAG Chr17:26275765..26275784 59.58 60 TTCAAAGTGGGCAGGTATCC Chr17:26280371..26280390 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000481123 Chr17:26275679..26275986 AGAGGGCTGGTGAGAGTGAG Chr17:26275765..26275784 59.58 60

*** Putative Vector Insertion (Chr 17: 26275987 - 26279562) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000338070 Chr17:26279563..26280521 TTCAAAGTGGGCAGGTATCC Chr17:26280371..26280390 59.93 50
downstream ENSMUSE00000714239 Chr17:26279563..26280521 TTCAAAGTGGGCAGGTATCC Chr17:26280371..26280390 59.93 50
downstream ENSMUSE00000447880 Chr17:26310585..26310725 AGCATCACTGGACAGGCTCT Chr17:26310699..26310718 60.02 55
downstream ENSMUSE00000139227 Chr17:26319435..26319531 CGCCCATTGACTTGGATACT Chr17:26319512..26319531 59.96 50
downstream ENSMUSE00000139224 Chr17:26321122..26321259 GCTCTACCCGGATCTCCTTT Chr17:26321161..26321180 59.67 55
downstream ENSMUSE00000139222 Chr17:26324649..26325166 CTGCGTTCTCGGAATAGCTC Chr17:26325135..26325154 60.12 55
downstream ENSMUSE00000139219 Chr17:26325519..26325689 CATTGGCATTCTTCCCAGAT Chr17:26325586..26325605 59.89 45
downstream ENSMUSE00000139221 Chr17:26326931..26327176 GGACAGAATTCCGAAGCTGA Chr17:26327043..26327062 60.34 50
downstream ENSMUSE00000139223 Chr17:26329461..26329568 AGAGTTCCAAGTCCGACACG Chr17:26329561..26329580 60.3 55
downstream ENSMUSE00000139226 Chr17:26330884..26331051 AGCTCCCCTTCTTGGTTAGC Chr17:26331050..26331069 59.85 55
downstream ENSMUSE00000507779 Chr17:26331880..26332756 AACCAGGTGCAGTGGATAGG Chr17:26332424..26332443 59.99 55
downstream ENSMUSE00000712042 Chr17:26331880..26332186 CACCTTGCCGATGATCTTTT Chr17:26331994..26332013 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAAAGTGTGGAAGGTAGCC Chr17:26275972..26275992 59.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAAAGTGTGGAAGGTAGCC Chr17:26275972..26275992 59.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024182