Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29809
Trapped Gene
Zfp598 (ENSMUSG00000041130)
Vector Insertion
Chr 17: 24806919 - 24813498
Public Clones E062D02 (ggtc) D160D02 (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702311 (Chr17:24806697..24806918 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTACCGGTGCTCTACCAAG Chr17:24806842..24806861 59.9 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702311 (Chr17:24806697..24806918 +)
Downstram Exon
ENSMUSE00000339149 (Chr17:24813499..24813611 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTACCGGTGCTCTACCAAG Chr17:24806842..24806861 59.9 60 TTCTCGTGTTGGAGCTGATG Chr17:24813566..24813585 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702311 Chr17:24806697..24806918 GCTACCGGTGCTCTACCAAG Chr17:24806842..24806861 59.9 60

*** Putative Vector Insertion (Chr 17: 24806919 - 24813498) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339149 Chr17:24813499..24813611 TTCTCGTGTTGGAGCTGATG Chr17:24813566..24813585 59.98 50
downstream ENSMUSE00000373546 Chr17:24814001..24814130 GAGGTGCTTGAGGCACAACT Chr17:24814130..24814149 60.45 55
downstream ENSMUSE00000406447 Chr17:24814355..24814566 CCACTTGCGTTCATAGGTGA Chr17:24814381..24814400 59.72 50
downstream ENSMUSE00000367398 Chr17:24814780..24814997 CACGCAGGTAGGCATAGTCA Chr17:24814802..24814821 59.89 55
downstream ENSMUSE00000302173 Chr17:24815541..24815658 GCGATTGTACCTGTCCACCT Chr17:24815590..24815609 60 55
downstream ENSMUSE00000302147 Chr17:24815982..24816169 TGCCACTTCTCGGTCTTCTT Chr17:24816009..24816028 59.99 50
downstream ENSMUSE00000302124 Chr17:24816266..24816350 GGGAAGGCTTCTTGGCTTAC Chr17:24816317..24816336 60.21 55
downstream ENSMUSE00000302101 Chr17:24816454..24817220 GGGTAGGTTCCCTTTCTTGC Chr17:24816715..24816734 59.94 55
downstream ENSMUSE00000551933 Chr17:24816454..24817047 GGGTAGGTTCCCTTTCTTGC Chr17:24816715..24816734 59.94 55
downstream ENSMUSE00000551928 Chr17:24817132..24817220 CCTCCGAGAGCTGGAAAGTC Chr17:24817191..24817210 61.44 60
downstream ENSMUSE00000386866 Chr17:24817569..24817743 GTGGTGTGCCCTTCAAGAGT Chr17:24817607..24817626 60.16 55
downstream ENSMUSE00000302035 Chr17:24817826..24817976 TTCTCTCCCGGAAATTCTCA Chr17:24817887..24817906 59.74 45
downstream ENSMUSE00000702299 Chr17:24818054..24818960 AGGTCCCTGCAGCTCTTGTA Chr17:24818100..24818119 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:24806969..24806989 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTCCTGATGCGTGACTGG Chr17:24806959..24806979 61.88 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041130