Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29812
Trapped Gene
Shroom3 (ENSMUSG00000029381)
Vector Insertion
Chr 5: 93238588 - 93327023
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
E060G11 (ggtc) D098E08 (ggtc) (ggtc) D099A12 (ggtc) (ggtc)
D098E08 (ggtc) (ggtc) E060G11 (ggtc) D099A12 (ggtc) (ggtc)
(ggtc) CMHD-GT_525E3-5S (cmhd) IST15003D2 (tigm) IST14495H11 (tigm)
IST14953H6 (tigm) IST15078H2 (tigm) IST13411H2 (tigm) IST14739D4 (tigm)
IST12646G10 (tigm) IST10065E7 (tigm) IST14621E1 (tigm) IST12349F8 (tigm)
IST14364G4 (tigm) IST15072C6 (tigm) IST14690D3 (tigm) IST14670E2 (tigm)
IST14736C8 (tigm) IST10874D10 (tigm) IST15069G4 (tigm) IST12842H8 (tigm)
IST12646G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694089 (Chr5:93238414..93238587 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAGCTCGACTGTGTGTCA Chr5:93238501..93238520 60.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694089 (Chr5:93238414..93238587 +)
Downstram Exon
ENSMUSE00000694084 (Chr5:93327024..93327246 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAGCTCGACTGTGTGTCA Chr5:93238501..93238520 60.53 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000475607 Chr5:93112461..93112857 CCCACGGAGAGATTCGTTTA Chr5:93112750..93112769 60.07 50
upstream ENSMUSE00000321238 Chr5:93209779..93209933 AAGCTGGGGACGAAGTCATA Chr5:93209822..93209841 59.69 50
upstream ENSMUSE00000694089 Chr5:93238414..93238587 ACCAGCTCGACTGTGTGTCA Chr5:93238501..93238520 60.53 55

*** Putative Vector Insertion (Chr 5: 93238588 - 93327023) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000694084 Chr5:93327024..93327246 No primer for this exon
downstream ENSMUSE00000321233 Chr5:93348671..93348802 CCTCCTGACCATGTTGCTTT Chr5:93348781..93348800 60.11 50
downstream ENSMUSE00000694088 Chr5:93348671..93348802 CCTCCTGACCATGTTGCTTT Chr5:93348781..93348800 60.11 50
downstream ENSMUSE00000321231 Chr5:93362780..93362911 GTAGCTCTGGTGCCAAGGAG Chr5:93362906..93362925 60.01 60
downstream ENSMUSE00000694087 Chr5:93362780..93362911 GTAGCTCTGGTGCCAAGGAG Chr5:93362906..93362925 60.01 60
downstream ENSMUSE00000694094 Chr5:93369003..93372165 TAGGAGCGCTTCTTCTGCTC Chr5:93371459..93371478 60 55
downstream ENSMUSE00000188405 Chr5:93377430..93377503 No primer for this exon
downstream ENSMUSE00000188402 Chr5:93379510..93380346 CAGGGCTTCTTGGACTGGTA Chr5:93379865..93379884 60.25 55
downstream ENSMUSE00000321188 Chr5:93381565..93382056 TTTCCTCTTTGCGCCACTAT Chr5:93382015..93382034 59.85 45
downstream ENSMUSE00000321182 Chr5:93384287..93384437 CTCCGGCATGTCTTTGATTT Chr5:93384395..93384414 60.07 45
downstream ENSMUSE00000321177 Chr5:93391117..93391389 TTCAGCTTGATGTCCGTGAG Chr5:93391202..93391221 59.98 50
downstream ENSMUSE00000483674 Chr5:93393382..93394785 TTGCCTACATCCACCACAAA Chr5:93394287..93394306 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACAGGGAATGGAGTGGTA Chr5:93241580..93241600 60.77 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACAGGGAATGGAGTGGTA Chr5:93241580..93241600 60.77 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029381