Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29821
Trapped Gene
Prkacb (ENSMUSG00000005034)
Vector Insertion
Chr 3: 146420670 - 146433226
Public Clones (sanger) (ggtc) (ggtc) E057H05 (ggtc) (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668743 (Chr3:146432898..146433225 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668743 (Chr3:146432898..146433225 -)
Downstram Exon
ENSMUSE00000488638 (Chr3:146420671..146420732 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661799 Chr3:146475602..146475894 No primer for this exon
upstream ENSMUSE00000635310 Chr3:146444111..146444297 No primer for this exon
upstream ENSMUSE00000668746 Chr3:146434156..146434165 No primer for this exon
upstream ENSMUSE00000668745 Chr3:146433480..146433745 No primer for this exon
upstream ENSMUSE00000668743 Chr3:146432898..146433225 No primer for this exon
upstream ENSMUSE00000488638 Chr3:146420671..146420732 No primer for this exon

*** Putative Vector Insertion (Chr 3: 146420670 - 146433226) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000485712 Chr3:146418596..146418724 No primer for this exon
downstream ENSMUSE00000177080 Chr3:146414411..146414509 No primer for this exon
downstream ENSMUSE00000177081 Chr3:146413447..146413529 No primer for this exon
downstream ENSMUSE00000177086 Chr3:146410885..146411011 No primer for this exon
downstream ENSMUSE00000177085 Chr3:146409564..146409659 No primer for this exon
downstream ENSMUSE00000478731 Chr3:146408224..146408346 No primer for this exon
downstream ENSMUSE00000508616 Chr3:146400898..146401062 No primer for this exon
downstream ENSMUSE00000668744 Chr3:146392829..146395677 No primer for this exon
downstream ENSMUSE00000668754 Chr3:146392544..146395677 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTTTGGGTTTTATGGGTTT Chr3:146433205..146433226 59.13 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACCGTGACTGGGAAAAC Chr3:146433160..146433180 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005034