Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29824
Trapped Gene
Adra1b (ENSMUSG00000050541)
Vector Insertion
Chr 11: 43588811 - 43649784
Public Clones E057G04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000423607 (Chr11:43648642..43649783 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCTTGGGCATTGTAGTCG Chr11:43648690..43648709 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000423607 (Chr11:43648642..43649783 -)
Downstram Exon
ENSMUSE00000469661 (Chr11:43588812..43589961 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCTTGGGCATTGTAGTCG Chr11:43648690..43648709 59.99 50 CTGCCACTGTCATCCAGAGA Chr11:43589660..43589679 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423597 Chr11:43714596..43714695 TCTTAGCTTCGTGGCAACAG Chr11:43714649..43714668 59.22 50
upstream ENSMUSE00000347699 Chr11:43657739..43657888 AAAAGGCTTGTGTGGTTTGG Chr11:43657794..43657813 60.01 45
upstream ENSMUSE00000356594 Chr11:43650295..43650362 CTGAACCCATGGCTTGACTC Chr11:43650313..43650332 60.66 55
upstream ENSMUSE00000423607 Chr11:43648642..43649783 AACCTTGGGCATTGTAGTCG Chr11:43648690..43648709 59.99 50
upstream ENSMUSE00000512947 Chr11:43648642..43649834 AACCTTGGGCATTGTAGTCG Chr11:43648690..43648709 59.99 50
upstream ENSMUSE00000469661 Chr11:43588812..43589961 GAGGCTGCGCTTACACCTAC Chr11:43589753..43589772 60.04 60

*** Putative Vector Insertion (Chr 11: 43588811 - 43649784) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508013 Chr11:43588108..43589961 GGGACCCTAATTGTCTGCAA Chr11:43588450..43588469 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGCAGAGGCTGAACAGA Chr11:43649796..43649816 60.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGCAGAGGCTGAACAGA Chr11:43649796..43649816 60.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050541