Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29825
Trapped Gene
6430526N21Rik (ENSMUSG00000074405)
Vector Insertion
Chr 7: 4981740 - 4982764
Public Clones E057D04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677247 (Chr7:4981676..4981739 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAAGAAGCCTAGCCACCTC Chr7:4981695..4981714 59.57 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677247 (Chr7:4981676..4981739 +)
Downstram Exon
ENSMUSE00000677246 (Chr7:4982765..4982784 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAAGAAGCCTAGCCACCTC Chr7:4981695..4981714 59.57 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637483 Chr7:4971978..4972257 GTGTCTAGTGCCGGCGTAAT Chr7:4972034..4972053 60.16 55
upstream ENSMUSE00000677250 Chr7:4972172..4972257 No primer for this exon
upstream ENSMUSE00000465026 Chr7:4980593..4983809 AACACCAACTGGAGGTACGC Chr7:4981444..4981463 60.03 55
upstream ENSMUSE00000538366 Chr7:4980593..4982881 AACACCAACTGGAGGTACGC Chr7:4981444..4981463 60.03 55
upstream ENSMUSE00000677248 Chr7:4981340..4981431 CGCACCTACAACCATGTCTC Chr7:4981382..4981401 59.17 55
upstream ENSMUSE00000677247 Chr7:4981676..4981739 TCAAGAAGCCTAGCCACCTC Chr7:4981695..4981714 59.57 55

*** Putative Vector Insertion (Chr 7: 4981740 - 4982764) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677246 Chr7:4982765..4982784 No primer for this exon
downstream ENSMUSE00000677245 Chr7:4982810..4982844 No primer for this exon
downstream ENSMUSE00000637480 Chr7:4983231..4983478 CCGCTAGGCTAGAAGACTGC Chr7:4983380..4983399 59.38 60
downstream ENSMUSE00000637482 Chr7:4984365..4984825 TCGGGGTCTCAAATCAGTTC Chr7:4984452..4984471 60.05 50
downstream ENSMUSE00000677249 Chr7:4984365..4984740 TCGGGGTCTCAAATCAGTTC Chr7:4984452..4984471 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAAGAAGCCTAGCCACCTC Chr7:4981696..4981716 59.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAAGAAGCCTAGCCACCTC Chr7:4981696..4981716 59.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074405