Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29830
Trapped Gene
Zfp644 (ENSMUSG00000049606)
Vector Insertion
Chr 5: 107124816 - 107125617
Public Clones E054F12 (ggtc) E054F12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692758 (Chr5:107125551..107125616 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692758 (Chr5:107125551..107125616 -)
Downstram Exon
ENSMUSE00000692762 (Chr5:107124817..107124994 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTACAGGCCCGGACAGAGTA Chr5:107124923..107124942 60.27 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000541377 Chr5:107125551..107125849 AGCCGAGTAGCGTACAGAGC Chr5:107125618..107125637 59.81 60
upstream ENSMUSE00000692758 Chr5:107125551..107125616 No primer for this exon
upstream ENSMUSE00000692762 Chr5:107124817..107124994 TACTCTGTCCGGGCCTGTAG Chr5:107124945..107124964 60.27 60

*** Putative Vector Insertion (Chr 5: 107124816 - 107125617) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000708453 Chr5:107095804..107095864 No primer for this exon
downstream ENSMUSE00000713573 Chr5:107095804..107095864 No primer for this exon
downstream ENSMUSE00000719205 Chr5:107095804..107095864 No primer for this exon
downstream ENSMUSE00000596339 Chr5:107065566..107067654 TCTCCTCGTTTTGCCCTAGA Chr5:107066680..107066699 59.95 50
downstream ENSMUSE00000376578 Chr5:107065436..107067654 TCTCCTCGTTTTGCCCTAGA Chr5:107066680..107066699 59.95 50
downstream ENSMUSE00000596338 Chr5:107065436..107065564 CCCTGGCGTTAGGTTTTTCT Chr5:107065474..107065493 60.47 50
downstream ENSMUSE00000596337 Chr5:107064629..107065342 TGTCCTCGGACATGATTTGA Chr5:107064735..107064754 60.05 45
downstream ENSMUSE00000596343 Chr5:107064629..107065342 TGTCCTCGGACATGATTTGA Chr5:107064735..107064754 60.05 45
downstream ENSMUSE00000692766 Chr5:107064629..107067654 TGTCCTCGGACATGATTTGA Chr5:107064735..107064754 60.05 45
downstream ENSMUSE00000596336 Chr5:107063850..107064455 TCATCGCCTGAGGAGAGTTT Chr5:107064169..107064188 59.95 50
downstream ENSMUSE00000596342 Chr5:107063850..107064455 TCATCGCCTGAGGAGAGTTT Chr5:107064169..107064188 59.95 50
downstream ENSMUSE00000692753 Chr5:107053104..107053409 AAAGTCCAACAGCGCAGACT Chr5:107053241..107053260 60.06 50
downstream ENSMUSE00000596335 Chr5:107048559..107048661 TGTAAACCTCGTCAGCACCA Chr5:107048550..107048569 60.3 50
downstream ENSMUSE00000596341 Chr5:107048559..107048661 TGTAAACCTCGTCAGCACCA Chr5:107048550..107048569 60.3 50
downstream ENSMUSE00000651492 Chr5:107046092..107047447 TGCCCTATTTGAGGGAACAG Chr5:107046725..107046744 60.07 50
downstream ENSMUSE00000692756 Chr5:107045763..107047447 GCACCGTACTGTCCATTCCT Chr5:107046058..107046077 60 55
downstream ENSMUSE00000692749 Chr5:107045761..107047447 GCACCGTACTGTCCATTCCT Chr5:107046058..107046077 60 55
downstream ENSMUSE00000692768 Chr5:107045761..107047447 GCACCGTACTGTCCATTCCT Chr5:107046058..107046077 60 55
downstream ENSMUSE00000692760 Chr5:107045760..107047447 GCACCGTACTGTCCATTCCT Chr5:107046058..107046077 60 55
downstream ENSMUSE00000541363 Chr5:107045758..107047447 GCACCGTACTGTCCATTCCT Chr5:107046058..107046077 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000049606