Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29838
Trapped Gene
Slc12a4 (ENSMUSG00000017765)
Vector Insertion
Chr 8: 108484575 - 108489940
Public Clones (sanger) (sanger) E051D11 (ggtc) (ggtc) D071D06 (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706332 (Chr8:108489825..108489939 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706332 (Chr8:108489825..108489939 -)
Downstram Exon
ENSMUSE00000225355 (Chr8:108484576..108484670 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706332 Chr8:108489825..108489939 No primer for this exon
upstream ENSMUSE00000390713 Chr8:108489819..108489997 No primer for this exon
upstream ENSMUSE00000225355 Chr8:108484576..108484670 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108484575 - 108489940) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000510566 Chr8:108483258..108483389 No primer for this exon
downstream ENSMUSE00000214470 Chr8:108479481..108479627 No primer for this exon
downstream ENSMUSE00000580307 Chr8:108479327..108479381 No primer for this exon
downstream ENSMUSE00000580305 Chr8:108477708..108477838 No primer for this exon
downstream ENSMUSE00000214489 Chr8:108475680..108475921 No primer for this exon
downstream ENSMUSE00000214488 Chr8:108475322..108475536 No primer for this exon
downstream ENSMUSE00000214467 Chr8:108474596..108474760 No primer for this exon
downstream ENSMUSE00000214480 Chr8:108474405..108474503 No primer for this exon
downstream ENSMUSE00000214472 Chr8:108474097..108474154 No primer for this exon
downstream ENSMUSE00000580298 Chr8:108473554..108473728 No primer for this exon
downstream ENSMUSE00000214490 Chr8:108473038..108473156 No primer for this exon
downstream ENSMUSE00000580296 Chr8:108471753..108471851 No primer for this exon
downstream ENSMUSE00000580294 Chr8:108471393..108471512 No primer for this exon
downstream ENSMUSE00000580292 Chr8:108470957..108471061 No primer for this exon
downstream ENSMUSE00000225024 Chr8:108470591..108470759 No primer for this exon
downstream ENSMUSE00000224993 Chr8:108469745..108469940 No primer for this exon
downstream ENSMUSE00000580288 Chr8:108469461..108469630 No primer for this exon
downstream ENSMUSE00000580286 Chr8:108469240..108469371 No primer for this exon
downstream ENSMUSE00000214487 Chr8:108469035..108469142 No primer for this exon
downstream ENSMUSE00000214475 Chr8:108468422..108468606 No primer for this exon
downstream ENSMUSE00000580283 Chr8:108468175..108468308 No primer for this exon
downstream ENSMUSE00000344910 Chr8:108467493..108468073 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTTAATCGCCTTGCAGCAC Chr8:108489872..108489893 62.18 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGACTCGTGACTGGGAAAAC Chr8:108486874..108486894 60.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017765