Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29864
Trapped Gene
Fignl1 (ENSMUSG00000035455)
Vector Insertion
Chr 11: 11706098 - 11708936
Public Clones (sanger) (sanger) (sanger) E042B06 (ggtc) D083H10 (ggtc) D077A06 (ggtc)
(ggtc) PST22420-NR (escells) IST14959B1 (tigm) IST14215F10 (tigm)
IST14711C4 (tigm) IST12125H10 (tigm) IST14234H4 (tigm) IST13486F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444730 (Chr11:11708898..11708935 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444730 (Chr11:11708898..11708935 -)
Downstram Exon
ENSMUSE00000330044 (Chr11:11706099..11706218 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGATTATGACCAACGGCAGA Chr11:11706092..11706111 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444730 Chr11:11708898..11708935 No primer for this exon
upstream ENSMUSE00000330044 Chr11:11706099..11706218 GAACTCGGCCTTGATTTCTG Chr11:11706130..11706149 59.81 50

*** Putative Vector Insertion (Chr 11: 11706098 - 11708936) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681146 Chr11:11705962..11706218 TGATTATGACCAACGGCAGA Chr11:11706092..11706111 60.07 45
downstream ENSMUSE00000681145 Chr11:11700555..11703066 CCCATCAGACTGCTGCACTA Chr11:11701202..11701221 60.01 55
downstream ENSMUSE00000330037 Chr11:11700291..11703066 CCCATCAGACTGCTGCACTA Chr11:11701202..11701221 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000035455