Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29866
Trapped Gene
Dnajc5 (ENSMUSG00000000826)
Vector Insertion
Chr 2: 181255993 - 181281075
Public Clones (sanger) (sanger) (sanger) E041G02 (ggtc) E041G02 (ggtc) IST13682C8 (tigm)
IST10088B2 (tigm) IST13682E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678049 (Chr2:181255940..181255992 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678049 (Chr2:181255940..181255992 +)
Downstram Exon
ENSMUSE00000712592 (Chr2:181281076..181281193 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000509198 Chr2:181255210..181255402 No primer for this exon
upstream ENSMUSE00000706029 Chr2:181255231..181255402 No primer for this exon
upstream ENSMUSE00000678050 Chr2:181255256..181255402 No primer for this exon
upstream ENSMUSE00000678047 Chr2:181255652..181255763 No primer for this exon
upstream ENSMUSE00000678049 Chr2:181255940..181255992 No primer for this exon

*** Putative Vector Insertion (Chr 2: 181255993 - 181281075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170834 Chr2:181281076..181281193 No primer for this exon
downstream ENSMUSE00000712592 Chr2:181281076..181281193 No primer for this exon
downstream ENSMUSE00000170833 Chr2:181282045..181282258 No primer for this exon
downstream ENSMUSE00000170835 Chr2:181283375..181283546 No primer for this exon
downstream ENSMUSE00000706028 Chr2:181283631..181283705 No primer for this exon
downstream ENSMUSE00000545485 Chr2:181283978..181286932 No primer for this exon
downstream ENSMUSE00000678046 Chr2:181283978..181284295 No primer for this exon
downstream ENSMUSE00000678048 Chr2:181283978..181286937 No primer for this exon
downstream ENSMUSE00000678052 Chr2:181283978..181284077 No primer for this exon
downstream ENSMUSE00000706027 Chr2:181283978..181286938 No primer for this exon
downstream ENSMUSE00000678051 Chr2:181285618..181285636 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTTGTAATCGCCTTGCAG Chr2:181268038..181268058 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr2:181268040..181268060 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000826