Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29870
Trapped Gene
2410002O22Rik (ENSMUSG00000078936)
Vector Insertion
Chr 13: 104963801 - 104968520
Public Clones E040H02 (ggtc) D065A12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569059 (Chr13:104968194..104968519 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCAGCAAGAAGTGGATCG Chr13:104968480..104968499 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569059 (Chr13:104968194..104968519 -)
Downstram Exon
ENSMUSE00000569058 (Chr13:104963802..104965084 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCAGCAAGAAGTGGATCG Chr13:104968480..104968499 59.98 50 CAGCTGTTTGGGATCGTTTT Chr13:104964888..104964907 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000569059 Chr13:104968194..104968519 TGTCAGCAAGAAGTGGATCG Chr13:104968480..104968499 59.98 50
upstream ENSMUSE00000569058 Chr13:104963802..104965084 GCCATCTCAGAACCTGGTGT Chr13:104964731..104964750 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr13:104968450..104968470 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAACATGCGTGACTGGGAAA Chr13:104968456..104968476 61.47 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078936