Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29872
Trapped Gene
Wdr5 (ENSMUSG00000026917)
Vector Insertion
Chr 2: 27375337 - 27375846
Public Clones E040E05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164109 (Chr2:27375263..27375336 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTGGGGAGCATATGATGG Chr2:27375283..27375302 59.6 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164109 (Chr2:27375263..27375336 +)
Downstram Exon
ENSMUSE00000164111 (Chr2:27375847..27375936 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTGGGGAGCATATGATGG Chr2:27375283..27375302 59.6 45 GAGGCAGACACAAGGAGGTT Chr2:27375902..27375921 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377460 Chr2:27370726..27370800 No primer for this exon
upstream ENSMUSE00000229041 Chr2:27374149..27374312 CATTGTGACTCCCCCTTCAC Chr2:27374184..27374203 60.36 55
upstream ENSMUSE00000164104 Chr2:27374869..27374977 AAGCCAAACTATGCCCTGAA Chr2:27374881..27374900 59.71 45
upstream ENSMUSE00000164109 Chr2:27375263..27375336 ATTTGGGGAGCATATGATGG Chr2:27375283..27375302 59.6 45

*** Putative Vector Insertion (Chr 2: 27375337 - 27375846) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000164111 Chr2:27375847..27375936 GAGGCAGACACAAGGAGGTT Chr2:27375902..27375921 59.31 55
downstream ENSMUSE00000164106 Chr2:27376093..27376182 ACCCTGAGACGATGAGGTTG Chr2:27376183..27376202 60.11 55
downstream ENSMUSE00000164101 Chr2:27376348..27376431 TCACGTCCCATATCCTCACA Chr2:27376381..27376400 59.92 50
downstream ENSMUSE00000164112 Chr2:27380626..27380681 TCAATGATCCATCACGGTTG Chr2:27380656..27380675 60.33 45
downstream ENSMUSE00000164110 Chr2:27383794..27383840 No primer for this exon
downstream ENSMUSE00000697539 Chr2:27386472..27386519 CTCCGTTTCTCGTGACTGGT Chr2:27386502..27386521 60.3 55
downstream ENSMUSE00000164105 Chr2:27387159..27387234 GCCAGGATGTATTTGCCATT Chr2:27387222..27387241 59.79 45
downstream ENSMUSE00000164113 Chr2:27388513..27388546 CCCTTGCTGTAGTCCCAGAG Chr2:27388545..27388564 59.86 60
downstream ENSMUSE00000164103 Chr2:27388857..27388931 CACGGAGAAGTTGGCAAATA Chr2:27388922..27388941 58.77 45
downstream ENSMUSE00000164108 Chr2:27389288..27389375 CTCCTTGGTCTGCAGATTCC Chr2:27389350..27389369 59.8 55
downstream ENSMUSE00000351726 Chr2:27390277..27392053 CTGAGCTTGGCCACTACCTC Chr2:27391378..27391397 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCACTAGGTGTTGAGCA Chr2:27375353..27375373 59.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGCACTAGGTGTTGAGCA Chr2:27375353..27375373 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026917