Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29873
Trapped Gene
1600021P15Rik (ENSMUSG00000051065)
Vector Insertion
Chr 16: 28835236 - 28929785
Public Clones E039E05 (ggtc) IST14938B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644537 (Chr16:28929539..28929784 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAATACGACGACCAGAGA Chr16:28929585..28929604 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644537 (Chr16:28929539..28929784 -)
Downstram Exon
ENSMUSE00000351664 (Chr16:28835237..28835258 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAATACGACGACCAGAGA Chr16:28929585..28929604 60.07 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644537 Chr16:28929539..28929784 GGGAATACGACGACCAGAGA Chr16:28929585..28929604 60.07 55
upstream ENSMUSE00000351664 Chr16:28835237..28835258 No primer for this exon

*** Putative Vector Insertion (Chr 16: 28835236 - 28929785) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644536 Chr16:28826262..28829095 TCTTCGGTGATCTTCCCATC Chr16:28828491..28828510 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTTAGTCCCAAATGAAAC Chr16:28902799..28902820 59.08 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCTTAGTCCCAAATGAAAC Chr16:28902799..28902820 59.08 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051065