Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29874
Trapped Gene
Etv5 (ENSMUSG00000013089)
Vector Insertion
Chr 16: 22421891 - 22436001
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) D073C08 (ggtc)
E038C11 (ggtc) D073C08 (ggtc) E039C09 (ggtc) CMHD-GT_540D1-5S (cmhd) IST14445H5 (tigm)
IST10917A12 (tigm) IST14272F9 (tigm) IST14904D1 (tigm) IST13272E11 (tigm)
IST11577C7HMF1 (tigm) IST10917A12 (tigm) IST10308B9 (tigm) IST11466B12 (tigm)
IST14699B2 (tigm) IST10102C8 (tigm) IST10308B9 (tigm) IST10102D1 (tigm)
IST12917F2 (tigm) IST13247G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000478899 (Chr16:22435950..22436000 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000478899 (Chr16:22435950..22436000 -)
Downstram Exon
ENSMUSE00000644755 (Chr16:22421892..22421945 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000560923 Chr16:22439590..22439691 No primer for this exon
upstream ENSMUSE00000407999 Chr16:22436511..22436633 No primer for this exon
upstream ENSMUSE00000378517 Chr16:22436274..22436361 No primer for this exon
upstream ENSMUSE00000310554 Chr16:22436093..22436140 No primer for this exon
upstream ENSMUSE00000478899 Chr16:22435950..22436000 No primer for this exon
upstream ENSMUSE00000644755 Chr16:22421892..22421945 No primer for this exon

*** Putative Vector Insertion (Chr 16: 22421891 - 22436001) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000414095 Chr16:22412918..22413047 No primer for this exon
downstream ENSMUSE00000497015 Chr16:22411706..22411993 No primer for this exon
downstream ENSMUSE00000362934 Chr16:22401745..22402004 No primer for this exon
downstream ENSMUSE00000310460 Chr16:22399393..22399452 No primer for this exon
downstream ENSMUSE00000310522 Chr16:22393060..22393128 No primer for this exon
downstream ENSMUSE00000131370 Chr16:22392728..22392897 No primer for this exon
downstream ENSMUSE00000560895 Chr16:22386830..22386931 No primer for this exon
downstream ENSMUSE00000702629 Chr16:22381385..22383764 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr16:22423933..22423953 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGTCCATGGCCTAAATCA Chr16:22423965..22423985 59.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013089