Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2988
Trapped Gene
Cog3 (ENSMUSG00000034893)
Vector Insertion
Chr 14: 76147007 - 76154071
Public Clones AA0089 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518663 (Chr14:76154072..76154300 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGAGAAGCTGTCTCTCTGG Chr14:76154171..76154190 60.43 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518663 (Chr14:76154072..76154300 -)
Downstram Exon
ENSMUSE00000276015 (Chr14:76146860..76147006 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGAGAAGCTGTCTCTCTGG Chr14:76154171..76154190 60.43 60 CTGCGCAGTCTCAATCCTTT Chr14:76146841..76146860 60.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518663 Chr14:76154072..76154300 GCGAGAAGCTGTCTCTCTGG Chr14:76154171..76154190 60.43 60

*** Putative Vector Insertion (Chr 14: 76147007 - 76154071) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000276015 Chr14:76146860..76147006 CTGCGCAGTCTCAATCCTTT Chr14:76146841..76146860 60.54 50
downstream ENSMUSE00000276005 Chr14:76143373..76143434 CCTTCATCCTGATCCATCTGA Chr14:76143363..76143383 60.02 47.62
downstream ENSMUSE00000275991 Chr14:76142148..76142313 TTCTGCAACGACTCCTGATG Chr14:76142196..76142215 59.98 50
downstream ENSMUSE00000276201 Chr14:76141488..76141562 GTTGGATGTGCTCAGCAAGA Chr14:76141507..76141526 59.99 50
downstream ENSMUSE00000276194 Chr14:76140343..76140435 TCACAGACAACGTAGGGGAAT Chr14:76140386..76140406 59.46 47.62
downstream ENSMUSE00000276185 Chr14:76139311..76139436 GTCTTCATGAGGTGCAAAGC Chr14:76139338..76139357 58.44 50
downstream ENSMUSE00000276170 Chr14:76137770..76137850 AGGCATTGTCTGCATTAGGG Chr14:76137795..76137814 60.1 50
downstream ENSMUSE00000275970 Chr14:76133705..76133748 GGGTATCTTTTCAGATCGTTGC Chr14:76133685..76133706 59.97 45.46
downstream ENSMUSE00000276157 Chr14:76132718..76132844 CTCCCGCTGATCAAGGTAAC Chr14:76132771..76132790 59.69 55
downstream ENSMUSE00000276148 Chr14:76131783..76131874 ATGGACCATAAAGGCACAGC Chr14:76131823..76131842 59.96 50
downstream ENSMUSE00000276136 Chr14:76130402..76130541 CAACGACACGCACAATTTCT Chr14:76130489..76130508 59.76 45
downstream ENSMUSE00000276121 Chr14:76129078..76129238 TAGCCTGTGATGTCCGTCTG Chr14:76129108..76129127 59.85 55
downstream ENSMUSE00000275948 Chr14:76127515..76127620 No primer for this exon
downstream ENSMUSE00000275936 Chr14:76124518..76124642 TGGAGAGATCGTCGTCTGTG Chr14:76124574..76124593 59.98 55
downstream ENSMUSE00000276095 Chr14:76121909..76121998 TGATGCTCCTAGCAAGGACTG Chr14:76121908..76121928 60.54 52.38
downstream ENSMUSE00000276089 Chr14:76119499..76119619 TTTCTTGAGGTCCAGGGAAA Chr14:76119484..76119503 59.64 45
downstream ENSMUSE00000276082 Chr14:76116916..76117004 TCAAGGCATTGTTGCTATTCA Chr14:76116911..76116931 59.31 38.1
downstream ENSMUSE00000276075 Chr14:76116675..76116809 GACTTCAGGTGCCGGTCTAC Chr14:76116723..76116742 59.73 60
downstream ENSMUSE00000275913 Chr14:76113008..76113083 GCTGTGAGAGGGTGTACTTGG Chr14:76113004..76113024 59.78 57.14
downstream ENSMUSE00000276062 Chr14:76107729..76107856 GCCATGCTTCTCAGTGTCAG Chr14:76107759..76107778 59.58 55
downstream ENSMUSE00000276051 Chr14:76106897..76106995 CCTTTAGCAGAGCGTGGAAC Chr14:76106928..76106947 60.01 55
downstream ENSMUSE00000379852 Chr14:76102158..76103867 TCCGATTCCAACTCAACCTC Chr14:76103355..76103374 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGAGGGAGGCTCTGATTG Chr14:76151044..76151064 59.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGAGGGAGGCTCTGATTG Chr14:76151044..76151064 59.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034893